Publish your application｜Mash up the Linked Open Data

forked:PromoterCAD Beginning Tutorial 1 - example application

Save a snapshot
reload

Import an externally hosted application: URL
Check style

save
finish Editing
Cancel

JavaScript
CSS
HTML
Images
Input Data
ReadMe
Snapshots

API Reference (2.0)
Properties

forked:PromoterCAD Beginning Tutorial 1 - example application
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
http://code.highcharts.com/highcharts-more.js

history

forked:PromoterCAD Beginning Tutorial 1 - example application
http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css

history

forked:PromoterCAD Beginning Tutorial 1 - example application

history

forked:PromoterCAD Beginning Tutorial 1 - example application

if (typeof Application == "undefined" || !Application) {
	var Application = {};
}

Application.genocon = function() {
	this._init.apply(this, arguments);
};

Application.genocon.prototype = {
	
	CHAR_SEQ_EMPTY : "-",
	
	_baseSequence : null,
	_tooltip : null,
	_methodList : null,
	_appBaseLineSequence : null,
	_appMenuHandler : null,
	_validCharcters : ['A','T','C','G','-'],
	
	_default : {
		baseSequenceContainerId : "baseSequenceContainer",
		fixedSequenceClass : "fixedSequence",
		finishSequence : "finishSequence",
		finishSequenceContainer : "finishSequenceContainer",
		baseErrorMessageClass : "baseErrorMessage",
		errorMessageEnterSequence : "Please enter a sequence of minimum length {0}",
		errorMessageMaximumSequence : "Please enter a sequence of maximum length {0}",
		useButtonClass : "useButton",
		nextButtonClass : "nextButton",
		finishNowButtonClass : "finishNow",
		nextButtonContainerClass : "nextButtonContainer",
		collapseButton : "collapseButton",
		expandButton : "expandButton",
		removeButton : "removeButton",
		appContainerClass : "applicationContainer",
		appDataContainerClass : "applicationDataContainer",
		actionButtonContainer : "actionButtonContainer",
		actionResultContainer : "actionResultContainer",
		baseSequenceBoxClass : "baseSequenceBox",
		baseSequenceClass : "baseSequence",
		selectDataBaseList : "databaseList",
		selectMethodList : "optionList",
		databaseFilteringProperty : "#motif%20sequence",
		methodUrlProperty : "#application%20URL",
		baseSequenceMinLength : 50,
		baseSequenceMaxLength : 500,
		//applicationOptionClass : "applicationOptionRadio",
		analysisMethodComboClass : "analysisMethod",
		expressionDbComboClass : "expressionDb",
		dataColomboClass : "dataCol",
		analysisMethodContainer : "analysisMethodContainer",
		expressionDbContainer : "expressionDbContainer",
		dataColContainer : "dataColContainer",
		chkEmptySequenceId : "chkEmptySequnce",
		analysisMethodComboEmptyOptionText : "-- Select Analysis Method --",
		expressionDbComboEmptyOptionText : "-- Select Expression Database --",
		dataColColomboEmptyOptionText : "-- Select Data Collection --",
		manualMotifEntryToolName : "InputMotif",
		itemLabelPostfix : "Label",
		finishSequenceFixedClass : "finishSequenceFixed",
		repeatButtonClass : "repeatAgain",
		baseSequenceErrDivClass : "baseSequenceError"
	},
	
	_tag : {
		databaseTag : "database",
		methodTag : "method"
	},
	
	_tooltipName : {
		atGeneExpress : "atgenexpress",
		diurnal : "diurnal",
		selectDatabase : "selectdatabase",
		selectTool : "Select Tool",
		motifExpress : "motifexpress",
		motifCircatian : "motifcircadian",
		motifRank : "motifranking",
		motifQuery : "motifquery",
		inputMotif : "inputmotif",
		defaultSequence : "Base Sequence",
		fixedSequence : "gacccttcctctatataaggaagttcatttcatttggagaggacctcgac",
		finishNow : "Finish Now",
		next : "Next",
		expressionDb : "Expression Database",
		analysisMethod : "Analysis Method",
		dataCollection : "Data Collection",
		baseSequence : "Base Sequence",
		finishNow : "Finish Now",
		startButton : "Start"
	},
	
	_init : function() {
		this._methodList = [];
		this._initToolTip();
		this._initDefaultSequence();
		this._initAppBaseLineSequence();
		this._initLoadScript();
		this._initUseButtonListener();
		this._initAppMenuHanndler();
		this._initAnalysisMethodListener();
		this._initExpressionDbListener();
		this._initDataCollectionListener();
		this._initEmptySequenceCheckBox();
	},
	
	_initToolTip : function() {
		this._tooltip = new Application.tooltip();
	},
	
	_initEmptySequenceCheckBox : function() {
		var self = this;
		$("#" + this._default.chkEmptySequenceId).click(function() {
			if ($(this).is(":checked")) {
				var textArea = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass)
				$(textArea).attr("value","");
				self._fillEmptyBaseSequence();
				$(textArea).attr("disabled",true);
				$("div." + self._default.baseSequenceErrDivClass).hide();
			} else {
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",false);
			}
		});
		/* following two lines were added to correct the behaviour, if user just pressed F5 button to 
           refresh the browser. in that case if previously checkbox is unnchecked, even after pressing
           F5, it remains unchecked in the new window
        */
		$("#" + this._default.chkEmptySequenceId).attr("checked","checked");
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",true);
	},
	
	_initDefaultSequence : function() {
		var self = this;
		this._fillEmptyBaseSequence();
		$baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass);
		$baseInput.attr("value",$baseInput.val());
		$baseInput.keyup(function() {
			$baseInput.attr("value", $baseInput.val());
		});
		$("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceBoxClass).scrollLeft(10000);
		var timer = new Application.timer();
		var applyToolTip = function() {
			var dToolTip = self._getToolTip(self._tooltipName.defaultSequence);
			var fToolTip = self._getToolTip(self._tooltipName.fixedSequence);
			var toolToolTip = self._getToolTip(self._tooltipName.selectTool);
			var analysisCmbToolTip = self._getToolTip(self._tooltipName.analysisMethod);
			var expDbToolTip = self._getToolTip(self._tooltipName.expressionDb);
			var dataCollToolTip = self._getToolTip(self._tooltipName.dataCollection);
			var startButToolTip = self._getToolTip(self._tooltipName.startButton);
			if (dToolTip && fToolTip) {
				var labelPostfix = self._default.itemLabelPostfix;
				//$("#tests").html(dataCollToolTip);
				//$("#tests").attr("title",$("#tests").html());
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("title", dToolTip);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass + labelPostfix).attr("title", dToolTip);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).attr("title", fToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass).attr("title", analysisCmbToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass + labelPostfix).attr("title", analysisCmbToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass).attr("title", expDbToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass + labelPostfix).attr("title", expDbToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.dataColomboClass).attr("title", dataCollToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.dataColomboClass + labelPostfix).attr("title", dataCollToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.selectMethodList).attr("title", toolToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.selectMethodList + labelPostfix).attr("title", toolToolTip);
				
				$(" ." + self._default.useButtonClass).attr("title", startButToolTip);
			} else {
				timer.call(applyToolTip);
			}
		}
		applyToolTip();
	},
	
	_initAppBaseLineSequence : function() {
		this._appBaseLineSequence = new Application.baseLineSequence();
	},
	
	_initAppMenuHanndler : function() {
		this._appMenuHandler = new Application.MenuHandler()
	},
	
	_initLoadScript : function() {
		var self = this;
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileArray){
				$.each(fileArray, function(fileKey, fileName) {
					var getProperties = function(propertytList) {
						$.each(propertytList, function(propKey, propVal) {
							if (propVal.indexOf(self._default.methodUrlProperty) > -1) {
								self._loadPluginScriptList(workId, fileName, propVal);
								return false;
							}
						});
					}
					LinkData.getProperties(workId, fileName, getProperties);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag);
	},
	
	_initDefaultContainer : function() {
		this._initMethod();
		this._initActionButton();
		this._initMethodListener();
	},
	
	_initMethod : function() {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$("option", $select).remove();
		$select.append("<option value='-1' selected='selected'>-- Select Tool --</option>");
		$select.attr("title", self._getToolTip(self._tooltipName.selectTool));
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileArray){
				$.each(fileArray, function(fileKey, fileName) {
					var getSubjects = function(subjectList) {
						$.each(subjectList, function(subKey, subVal) {
							var label = self._getLabel(subVal);
							var tooltip = self._getToolTipByToolName(label);
							tooltip = (tooltip) ? tooltip : "";
							$select.append("<option value='" + label + "' title='" + tooltip + "'>" + label + "</option>");
							self._methodList.push(label);
						});
					}
					LinkData.getSubjects(workId, fileName, getSubjects);
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag);
	},
	
	_initActionButton : function() {
		var self = this;
		$("." + self._default.actionButtonContainer + " ." + self._default.collapseButton).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.appDataContainerClass).hide();
		});
		$("." + self._default.actionButtonContainer + " ." + self._default.expandButton).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.appDataContainerClass).show();
		});
		$("." + self._default.actionButtonContainer + " ." + self._default.removeButton).click(function() {
			if ($("." + self._default.appContainerClass).length == 1) {
				$("." + self._default.appContainerClass).hide();
				$("." + self._default.appContainerClass + " .actionResultContainer").html("");
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).show();
			} else {
				$(this).closest("." + self._default.appContainerClass).remove();
			}
		});
	},
	
	_scrollDown : function() {
		$("html, body").animate({ scrollTop: $(document).height() }, 1000);
	},
	
	// tool listner
	_initMethodListener : function() {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$select.change(function() {
			var selectedTool = $(this).val();
			if (selectedTool != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				if (selectedTool == self._default.manualMotifEntryToolName) {
					//$(parent).find("." + self._default.applicationOptionClass).hide();
					self._showSelectedPlugin(null,$(this));
				} else {
					//self._clearWorkingArea(this);
					//self._initMotifExpressOptions(this);
					self._fillAnalysisMethodCombo(this);
					$(parent).find("." + self._default.analysisMethodContainer).show();
				}
				self._resetDataMiningCombos(this);
				self._scrollDown();
			}
		});
	},
	
	_makeTheDomChangeOfComboSelect : function(comboSelecter, value) {
		$(comboSelecter + " option").each(function(i){
        	var optionVal = $(this).val();
			if (optionVal == value) {
				$(this).attr("selected",true);
			}
    	});
	},
	
	_initAnalysisMethodListener : function() {
		var self = this;
		var selecter = "." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass;
		var $select = $(selecter);
		$select.change(function() {
			var selectedAnalysisMethod = $(this).val();
			if (selectedAnalysisMethod != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				self._fillExpressionDBCombo(this);
				self._resetDataMiningCombos(this);
				$(parent).find("." + self._default.expressionDbContainer).show();
				self._scrollDown();
			}
		});
	},
	
	_initExpressionDbListener : function() {
		var self = this;
		var selector = "." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass
		var $select = $(selector);
		$select.change(function() {
			var selectedExpressionDb = $(this).val();
			if (selectedExpressionDb != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				self._fillDataCollectionCombo(this);
				self._resetDataMiningCombos(this);
				$(parent).find("." + self._default.dataColContainer).show();
				self._scrollDown();
			}
		});
	},
	
	_initDataCollectionListener : function() {
		var self = this;
		var selector = "." + self._default.appContainerClass + " ." + self._default.dataColomboClass;
		var $select = $(selector);
		$select.change(function() {
			var selectedDataCollection = $(this).val();
			if (selectedDataCollection != "-1") {
				self._showSelectedPlugin(selectedDataCollection,$(this));
				self._scrollDown();
			}
		});
	},
	
	_getSelectedTool : function(parentRef) {
		return $(parentRef).find("." + this._default.selectMethodList).val();
	},
	
	_getSelectedAnalysisMethod : function(parentRef) {
		var comboRef = $(parentRef).find("." + this._default.analysisMethodComboClass);
		if (comboRef.length > 0 && comboRef.is(":visible")) {
			return $(comboRef).val();
		} else {
			return "";
		}
	},
	/*
	_initMotifExpressOptions : function(context) {
		var self = this;
		var parent = $(context).closest("." + this._default.appContainerClass);
		//$(parent).find("." + self._default.applicationOptionClass).unbind('click');
		var selectedTool = $(context).val();
		if (selectedTool == "MotifExpress") {
			$(parent).find("." + self._default.applicationOptionClass).show();
			$(parent).find("." + self._default.applicationOptionClass).click(function() {
				var selectedDataCollection = $(parent).find("." + self._default.dataColomboClass);
				if ($(selectedDataCollection).is(":visible") && $(selectedDataCollection).val() != "-1") {
					self._showSelectedPlugin(selectedDataCollection.val(),$(this));
					//return;
				}	
			});
			// making motif max as the defaukt mthod
			$(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked")[0].checked=true;
		} else {
			$(parent).find("." + self._default.applicationOptionClass).hide();
		}
	},*/
	
	_resetDataMiningCombos : function(comboRef) {
		var parent = $(comboRef).closest("." + this._default.appContainerClass);
		var expressionDbContainer = $(parent).find("." + this._default.expressionDbContainer);
		var dataColContainer = $(parent).find(" ." + this._default.dataColContainer);
		var analysisMethodContainer = $(parent).find(" ." + this._default.analysisMethodContainer);
		var toolCombo = $(parent).find("." + this._default.selectMethodList);
		var comboClass = $(comboRef).attr("class");
		if (toolCombo.val() == this._default.manualMotifEntryToolName) {
			$(analysisMethodContainer).hide();
			$(expressionDbContainer).hide();
			$(dataColContainer).hide();
		} else {
			if (comboClass == this._default.selectMethodList) {
				$(analysisMethodContainer).show();
				$(expressionDbContainer).hide();
				$(dataColContainer).hide();
			} else if (comboClass == this._default.analysisMethodComboClass) {
				$(expressionDbContainer).hide();
				$(dataColContainer).hide();
			}
			$container = $(parent).find("." + this._default.actionResultContainer);
			$container.html("");
		}
		$(parent).find("." + this._default.finishSequenceContainer).hide()
		this._scrollDown();
		//$(parent).find("." + this._default.finishSequenceFixedClass).hide();
	},
	
	_showSelectedPlugin : function(selectedDataCollection,context) {
		var self = this;
		var info = null;
		if (selectedDataCollection) {
			info = this._appMenuHandler._getSelectedDbInfoUsingDataCollection(selectedDataCollection);
		}
		var parent = $(context).closest("." + this._default.appContainerClass);
		var method = $(parent).find("." + self._default.selectMethodList).val();
		var analysisMethod = $(parent).find("." + self._default.analysisMethodComboClass).val();
		$container = $(parent).find("." + self._default.actionResultContainer);
		$container.html("Loading...");
		//$(parent).find("." + this._default.applicationOptionClass).hide();
		$(parent).find("." + this._default.nextButtonContainerClass).hide();
		var date = new Date();
		var id = "container_id_" + date.getTime();
		//var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val();
		var fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).html();
		$container.attr("id", id);
		var func = function() {
			self._callback(parent, self);
		}
		var obj = {
			workId : (info) ? info.workId : "",
			fileName : (info) ? info.fileName : "",
			rankListWorkId : (info) ? info.rankListWorkId : "",
			plotingWorkId : (info) ? info.plotingWorkId : "",
			baseSequence : self._baseSequence,
			tooltip : self._tooltip,
			callback : func,
			//applicationOption : appOption,
			fixedSequence : fixedSeq,
			motifMethod : this._getSelectedAnalysisMethod(parent),
			dataColl : selectedDataCollection,
			analysisMethod : analysisMethod
		};
		
		eval(method)(id, obj);
		self._scrollDown();
	},
	
	_fillAnalysisMethodCombo : function(selectToolCmbRef) {
		var parent = $(selectToolCmbRef).closest("." + this._default.appContainerClass);
		var selectedTool = $(selectToolCmbRef).val();
		var analysisMethods = this._appMenuHandler._getFilteredDistinctAnalysisMethods(selectedTool);
		var analysisMethodCmb = $(parent).find("." + this._default.analysisMethodComboClass);
		this._fillCombo(analysisMethods, analysisMethodCmb, this._default.analysisMethodComboEmptyOptionText, this._tooltipName.analysisMethod);
	},
	
	_fillExpressionDBCombo : function(analysisMethodCmbRef) {
		var parent = $(analysisMethodCmbRef).closest("." + this._default.appContainerClass);
		var selectedTool = this._getSelectedTool(parent);
		var selectedAnalysisMethod = $(analysisMethodCmbRef).val();
		var expressionDbs = this._appMenuHandler._getFilteredDistinctExpressionDbs(selectedTool,selectedAnalysisMethod);
		var analysisMethodCmb = $(parent).find("." + this._default.expressionDbComboClass);
		this._fillCombo(expressionDbs, analysisMethodCmb, this._default.expressionDbComboEmptyOptionText, this._tooltipName.expressionDb);
	},
	
	_fillDataCollectionCombo : function(expressionDbRef) {
		var parent = $(expressionDbRef).closest("." + this._default.appContainerClass);
		var selectedTool = this._getSelectedTool(parent);
		var selectedAnalysisMethod = this._getSelectedAnalysisMethod(parent);
		var selectedExpressionDb = $(expressionDbRef).val();
		var dataCollections = this._appMenuHandler._getFilteredDistinctDataCollections(selectedTool,selectedAnalysisMethod,selectedExpressionDb);
		var dataColCmb = $(parent).find("." + this._default.dataColomboClass);
		this._fillCombo(dataCollections, dataColCmb, this._default.dataColColomboEmptyOptionText, this._tooltipName.dataCollection);
	},
		
	_fillCombo : function(optionsArr, cmbRef, firstOptionText, firstOptionToolTipKey) {
		$(cmbRef).empty();
		var toolTip = this._tooltip.getByKey(firstOptionToolTipKey);
		$(cmbRef).append("<option value='-1' title='"+ toolTip +"'>"+ firstOptionText +"</option>");
		for (var index = 0 ; index < optionsArr.length ; index++) {
			var option = optionsArr[index];
			toolTip = this._tooltip.getByKey(option);
			$(cmbRef).append("<option value='"+ option + "' title='"+ toolTip +"'>"+ option +"</option>");
		}	
	},

_fillEmptyBaseSequence : function() {
		var self = this, sb = [];
		for (var i = 0; i < self._default.baseSequenceMaxLength; i++) {
			sb[sb.length] = self.CHAR_SEQ_EMPTY;
		}
		$baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass);
		$baseInput.val(sb.join(""));
	},
	
	_loadPluginScriptList : function(workId, fileName, property) {
		var getTripleList = function(tripleList) {
			$.each(tripleList, function(tKey, tVal) {
				LinkDataUtil.loadScript(tVal.object);
			});
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTripleList);
	},
	
	_changeMethodList : function(dbKey) {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$select.attr("title", self._getToolTip(self._tooltipName.selectTool));
		$("option", $select).remove();
		$select.append("<option value='-1' selected='selected'>-- Select Tool --</option>");
		if (dbKey == -1) {
			return;
		}
		var arr = dbKey.split("|");
		var workId = arr[0];
		var fileName = arr[1];
		$.each(self._methodList, function(key, method) {
			self._addValidMethod($select, workId, fileName, method);
		});
	},
	
	_addValidMethod : function($select, workId, fileName, method) {
		var self = this;
		var getFilesByTag = function(fileList) {
			if (!fileList) {
				return;
			}
			$.each(fileList, function(fKey, fName) {
				if (fName === fileName) {
					var tooltip = self._getToolTipByToolName(method);
					tooltip = (tooltip) ? tooltip : "";
					$select.append("<option value='" + method + "' title='" + tooltip + "'>" + method + "</option>");
					return false;
				}
			});
		}
		LinkData.getFilesByTag(workId, method, getFilesByTag);
	},
	
	_initUseButtonListener : function() {
		var self = this;
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).click(function() {
			self._initDefaultContainer();
			$txtSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass);
			$fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass);
			self._hideError();
			if ($txtSeq.val().length > self._default.baseSequenceMaxLength) {
				self._showError(self._default.errorMessageMaximumSequence.replace("{0}", self._default.baseSequenceMaxLength));
				return;
			}
			self._showWarningForNonStandardCharsIfExists();
			if ($txtSeq.val().length < self._default.baseSequenceMaxLength) {
				var tmpVal = $txtSeq.val();
				var eVal = self._getExtraDefaultSequence(self._default.baseSequenceMaxLength - $txtSeq.val().length);
				$txtSeq.val(eVal + tmpVal);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("size", 500);
			}
			self._baseSequence = $txtSeq.val().toString().toLowerCase() + $fixedSeq.html();
			if (!self._baseSequence || self._baseSequence.length < self._default.baseSequenceMinLength) {
				self._showError(self._default.errorMessageEnterSequence.replace("{0}", self._default.baseSequenceMinLength));
			} else {
				//$txtSeq.attr('readonly', true).addClass("noborder");
				$(this).hide();
				$("." + self._default.appContainerClass).show();
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbContainer).hide();
		    	$("." + self._default.appContainerClass + " ." + self._default.dataColContainer).hide();
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodContainer).hide();
				$("." + self._default.appContainerClass + " ." + self._default.nextButtonContainerClass).hide();
				$("." + self._default.appContainerClass + " ." + self._default.finishSequenceContainer).hide()
			}
		});
	},
	
	_showWarningForNonStandardCharsIfExists : function() {
		var found = false;
		var txtSeq = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass).val();
		for (var i = 0 ; i < txtSeq.length ; i++) {
			var char = txtSeq.charAt(i).toString().toUpperCase();
			if (this._validCharcters.indexOf(char) == -1) {
				$("div." + this._default.baseSequenceErrDivClass).show();
				found = true;
				break;
			}
		}
		if (found == false) {
			$("div." + this._default.baseSequenceErrDivClass).hide();
		}
	},
	
	_callback : function(parent, self) {
		if (self._isSelectedManualMotif(parent)) {
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).hide();
			$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).hide();
			//self._initNextButtonListener();
		} else {
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).show();
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).attr("title", self._getToolTip(self._tooltipName.finishNow));
			$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).show();
			self._initFinishNowButtonListener();
		}
		$(parent).find("." + self._default.nextButtonContainerClass).show();
		$(parent).find("." + self._default.finishSequenceContainer).hide();
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).attr("title", self._getToolTip(self._tooltipName.next));
		$(parent).find("." + self._default.nextButtonContainerClass).show();
		self._initNextButtonListener();
		self._initRepeatButtonListner();
	},
	
	_isSelectedManualMotif : function(parent) {
		var toolCombo = $(parent).find("." + this._default.selectMethodList);
		var selectedTool = toolCombo.val();
		if (selectedTool == this._default.manualMotifEntryToolName) {
			return true;
		} else {
			return false;
		}
	},
	
	_initNextButtonListener : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).click(function() {
			$parent = $(this).closest("." + self._default.appContainerClass);
			$parent.find("." + self._default.nextButtonContainerClass).hide();
			$($parent).find("." + self._default.finishSequenceContainer).hide()
			var clone = $parent.clone(true);
			//$(clone).find("." + self._default.applicationOptionClass).hide();
			var text = $(clone).find(".replaceSequence").text();
			if (text && text.trim().length != 0) {
				self._baseSequence = text;
			}
			$(clone).find("." + self._default.actionResultContainer).html("");
			$(clone).find("." + self._default.nextButtonContainerClass).hide();
			$(clone).find("." + self._default.expressionDbContainer).hide();
		    $(clone).find(" ." + self._default.dataColContainer).hide();
			$(clone).find(" ." + self._default.analysisMethodContainer).hide();
			$parent.parent().append(clone);
			self._scrollDown();
		});
	},
	
	_initFinishNowButtonListener : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.nextButtonContainerClass).hide();
			$(parent).find("." + self._default.finishSequenceContainer).hide()
			var gene = $(parent).find(".replaceSequence .gene").val();
			var geneType = $(parent).find(".replaceSequence .geneType").val();
			if (gene && geneType) {
				var callback = function(bSequence) {
					self._showFinishedBaseSequence(parent, bSequence);
				}
				//self._appBaseLineSequence.getBaseSequence(gene, geneType, callback);
				self._appBaseLineSequence._getBaseSequence(gene, callback);
			} else {
				self._showFinishedBaseSequence(parent,self._baseSequence);
			}
			self._scrollDown();
		});
	},
	
	_initRepeatButtonListner : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).click(function() {
			$parent = $(this).closest("." + self._default.appContainerClass);
			$parent.find("." + self._default.nextButtonContainerClass).hide();
			$($parent).find("." + self._default.finishSequenceContainer).hide()
			var clone = $parent.clone(true);
			var text = $(clone).find(".replaceSequence").text();
			if (text && text.trim().length != 0) {
				self._baseSequence = text;
			}
			$(clone).find("." + self._default.actionResultContainer).html("");
			$(clone).find("." + self._default.nextButtonContainerClass).hide();
			// setting the values
			var tool = $($parent).find("." + self._default.selectMethodList).val();	
			var expressionDb = $($parent).find("." + self._default.expressionDbComboClass).val();
			//var dataCollection = $($parent).find("." + self._default.dataColomboClass).val();
			var analysisMethod = $($parent).find("." + self._default.analysisMethodComboClass).val();
			$(clone).find("." + self._default.selectMethodList).val(tool);
			$(clone).find("." + self._default.expressionDbComboClass).val(expressionDb);
		    //$(clone).find(" ." + self._default.dataColomboClass).val(dataCollection);
			$(clone).find(" ." + self._default.analysisMethodComboClass).val(analysisMethod);
			$parent.parent().append(clone);
			self._scrollDown();
		});
	},
	
	_showFinishedBaseSequence : function(parent, bSequence) {
		var self = this;
		var defaultSequence = $(parent).find(".replaceSequence").text()
		$(parent).find(".wrappedSequenceMotif").hide();	
		var html = self._getFinishedBaseSequence(defaultSequence, bSequence);
		var fixedSequence = self._getFixedSequence();
		$(parent).find("." + self._default.finishSequenceContainer).show();
		$(parent).find("." + self._default.finishSequenceFixedClass).html(fixedSequence);
		//$(parent).find("." + self._default.finishSequenceFixedClass).show();
		$(parent).find("." + self._default.finishSequence).html(html);
		$(parent).find("." + self._default.finishSequence).scrollLeft(10000);
	},
	
	_getFixedSequence : function() {
		var fixedSequence = $("#" + this._default.baseSequenceContainerId + " ." + this._default.fixedSequenceClass).html();
		return fixedSequence;
	},
	
	_getFinishedBaseSequence : function(defaultSequence, bSequence) {
		var self = this, sb = [];
		var fixedSequence = this._getFixedSequence();
		var uptoFixedSequence = defaultSequence.length - fixedSequence.length;
		for (var i = 0; i < defaultSequence.length; i++) {
			if (i > uptoFixedSequence - 1) {
				continue;
			}
			var dChar = defaultSequence.charAt(i);
			var bChar = bSequence.charAt(i);
			if (bChar) {
				if (dChar !== self.CHAR_SEQ_EMPTY) {
					sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>";
				} else {
					sb[sb.length] = bChar.toLowerCase();
				}
			} else {
				sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>";
			}
		}
		return sb.join("");
	},
	
	_getExtraDefaultSequence : function(count) {
		var self = this, sb = [];
		for (var i = 0; i < count; i++) {
			sb[sb.length] = self.CHAR_SEQ_EMPTY;
		}
		return sb.join("");
	},
	
	_getDatabaseOptionKey : function(workId, fileName) {
		return workId + "|" + fileName;
	},
	
	_getLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_showError : function(message) {
		var self = this;
		$errMsgEl = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass);
		$errMsgEl.html(message);
		$errMsgEl.show();
	},
	
	_hideError : function() {
		var self = this;
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass).hide();
	},
	
	_getToolTipByFileName : function(fileName) {
		var self = this;
		if (fileName) {
			if (fileName.toLowerCase().indexOf(self._tooltipName.atGeneExpress) > -1) {
				return self._getToolTip(self._tooltipName.atGeneExpress);
			} else if (fileName.toLowerCase().indexOf(self._tooltipName.diunal) > -1) {
				return self._getToolTip(self._tooltipName.diunal);
			}
		}
	},
	
	_getToolTipByToolName : function(tool) {
		var self = this;
		if (tool) {
			if (tool.toLowerCase().indexOf(self._tooltipName.motifExpress) > -1) {
				return self._getToolTip(self._tooltipName.motifExpress);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifCircatian) > -1) {
				return self._getToolTip(self._tooltipName.motifCircatian);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifRank) > -1) {
				return self._getToolTip(self._tooltipName.motifRank);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifQuery) > -1) {
				return self._getToolTip(self._tooltipName.motifQuery);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.inputMotif) > -1) {
				return self._getToolTip(self._tooltipName.inputMotif);
			}
		}
	},
	
	_getToolTip : function(key) {
		return this._tooltip.getByKey(key);
	}
	
};

Application.MenuHandler = function() {
	this._init.apply(this,arguments);
}

Application.MenuHandler.prototype = {
	
	_fullList : [],
	_currentFilteredList : [],
	_workId : null,
	_fileName : null,
	_fileProperties : null,
	
	_properties : {
		motifAnalysisMethod : "motif%20analysis%20method",
		geneExpressionData : "gene%20expression%20data",
		menuDisplayName : "menu%20display%20name",
		toolsList : "tool%20list",
		workIdInTest : "test.linkdata.org",
		workIdPublic : "linkdata.org",
		ranklistWorkIdTest : "rank%20list%20test.linkdata.org",
		ranklistWorkIdPublic : "rank%20list%20linkdata.org",
		plotingDataWorkIdTest :"plot%20in%20test.linkdata.org",
		plotingDataWorkIdPublic :"plot%20in%20linkdata.org"
    },
	
	_tags : {
		menuDataSourceTag : "menu"
	},
	
	_defaults : {
		linkdataTestUrl : "test.linkdata.org",
		linkdataPublicUrl : "linkdata.org",
	},
	
	_init : function(args) {
		this._initMenuDataSource();
	},
	
	_fillFileProperties : function() {
		var self = this;
		var setProperties = function(props) {
			self._fileProperties = props;
		};
		LinkData.getProperties(this._workId,this._fileName,setProperties);
	},
	
	_initMenuDataSource : function() {
		var self = this;
		var foundMenuFiles = [];
		var loadMenuFiles = function(resultList) {
			$.each(resultList, function(wId, fileList) {
				$.each(fileList, function(fileKey, fName) {
					var obj = {
						workId : wId,
						fileName : fName
					};
					foundMenuFiles.push(obj);
				});
			});
			self._foundMenuFiles = foundMenuFiles;
			self._loadMenuFileContent(foundMenuFiles);
			self._fillFileProperties();
		};
		LinkData.getFilesByTag(null, this._tags.menuDataSourceTag, loadMenuFiles);
	},
	
	_loadMenuFileContent : function(menuFiles) {
		var self = this;
		var addFileContent = function(triples) {
			for (var index = 0 ; index < triples.length ; index++) {
				self._fullList.push(triples[index]);
			}
		};
		if (menuFiles.length > 1) {
			alert("There can be only one file that can be tagged with 'menu'");
			return;
		}
		if (menuFiles.length == 0) {
			return;
		}
		var obj = menuFiles.shift(); // removing the first element
		this._fileName = obj.fileName;
		this._workId = obj.workId;
		LinkData.getTriples(this._workId,this._fileName,addFileContent,{start:1, end:2000});
	},
	
	
	_getFilteredAnalysisMethodTriples : function(toolName) {
		if (!(toolName)) return this._fullList;
		this._currentFilteredList = [];
		var listByTool = this._getTriplesByProperty(this._properties.toolsList,this._fullList);
		if (!listByTool) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByTool.length ; index++) {
			var triple = listByTool[index];
			if (triple.object) {
				var toolList = triple.object.split(",");
				for (var index1 = 0 ; index1 < toolList.length ; index1++) {
					var tool = toolList[index1];
					if (tool.trim() == toolName.trim()) {
						var subject = triple.subject;
						var otherPropTripleList = this._getTriplesBySubject(subject);
						for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
							var propTriple = otherPropTripleList[index1];
							//this._currentFilteredList.push(propTriple);
							filteredList.push(propTriple);
						}
						break;
					}
				}
			}
		}
	    return filteredList;
	},
	
	_getFilteredDistinctAnalysisMethods : function(toolName) {
		var filteredList = this._getFilteredAnalysisMethodTriples(toolName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.motifAnalysisMethod,filteredList);
		return distinctList;
	},
		
	_getFilteredExpressionDbTriples : function(toolName,analysisMethodName) {
		var listByTool = this._getFilteredAnalysisMethodTriples(toolName);
		var listByAnalysisMethod = this._getTriplesByProperty(this._properties.motifAnalysisMethod,listByTool);
		if (!listByAnalysisMethod) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByAnalysisMethod.length ; index++) {
			var triple = listByAnalysisMethod[index];
			if (triple.object) {
				var analysisMethod = triple.object;
				if (analysisMethod.trim() == analysisMethodName.trim()) {
					var subject = triple.subject;
					var otherPropTripleList = this._getTriplesBySubject(subject);
					for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
						var propTriple = otherPropTripleList[index1];
						//this._currentFilteredList.push(propTriple);
						filteredList.push(propTriple);
					}
				}
			}
		}
		return filteredList
	},
	
	_getFilteredDistinctExpressionDbs : function(toolName,analysisMethodName) {
		var filteredList = this._getFilteredExpressionDbTriples(toolName,analysisMethodName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.geneExpressionData,filteredList);
		return distinctList;
	},
		
	_getFilteredDataCollectionTriples : function(toolName,analysisMethodName,expressionDbName) {
		var listByExpDbs = this._getFilteredExpressionDbTriples(toolName,analysisMethodName);
		var listByGeneExp = this._getTriplesByProperty(this._properties.geneExpressionData,listByExpDbs);
		if (!listByGeneExp) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByGeneExp.length ; index++) {
			var triple = listByGeneExp[index];
			if (triple.object) {
				var exprssionDb = triple.object;
				if (exprssionDb.trim() == expressionDbName.trim()) {
					var subject = triple.subject;
					var otherPropTripleList = this._getTriplesBySubject(subject);
					for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
						var propTriple = otherPropTripleList[index1];
						//this._currentFilteredList.push(propTriple);
						filteredList.push(propTriple);
					}
				}
			}
		}
		return filteredList;
	},
		
	_getFilteredDistinctDataCollections : function(toolName,analysisMethodName,expressionDbName) {
		var filteredList = this._getFilteredDataCollectionTriples(toolName,analysisMethodName,expressionDbName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.menuDisplayName,filteredList);
		return distinctList;
	},
	
	_getSelectedDbInfoUsingDataCollection : function(dataCollectionName) {
		var matchingList = [];
		var outObj = null;
		var listByDataCollection = this._getTriplesByProperty(this._properties.menuDisplayName,this._currentFilteredList);
		if (!listByDataCollection) return null;
		for (var index = 0 ; index < listByDataCollection.length ; index++) {
			var triple = listByDataCollection[index];
			var dataCollection = triple.object;
			if (dataCollection == dataCollectionName) {
				matchingList.push(triple);
			}
		}
		if (matchingList.length > 1) {
			// this a error. because there can be only one matching triple
			alert("Data file error");
		} else {
			// getting other triples for found one
			var subject = matchingList.shift().subject;
			var workId, rankWorkId, plotingWorkId = null;
			var otherPropTripleList = this._getTriplesBySubject(subject);
			var workIdProperty = this._getWorkIdProperty();
			var rankWorkIdProp = this._getRankingWorkIdProperty();
			var plotingWorkIdProp = this._getPlotingWorkIdProperty();
			for (var index=0 ; index < otherPropTripleList.length ; index++) {
				var triple = otherPropTripleList[index];
				var prop = this._getProperty(triple.property);
				if (workIdProperty == prop) {
					workId = triple.object;
				}
				if (rankWorkIdProp == prop) {
					rankWorkId = triple.object;
				}
				if (plotingWorkIdProp == prop) {
					plotingWorkId = triple.object;
				}
				if (workId && rankWorkId && plotingWorkId) {
					break;
				}
			}
			var workIdComps = workId.split("/");
			var rankWorkIdComps = rankWorkId.split("/");
			var plotingWorkIdComps = plotingWorkId.split("/");
			var subjectComps = subject.split("#");
			outObj = {
				fileName : subjectComps[subjectComps.length-1],
				workId : workIdComps[workIdComps.length-1],
				rankListWorkId : rankWorkIdComps[rankWorkIdComps.length-1],
				plotingWorkId : plotingWorkIdComps[plotingWorkIdComps.length-1]
			};
		}
		return outObj;
	},
	
	_getProperty : function(propertyUrl) {
		var comps = propertyUrl.split("#");
		return comps[comps.length-1];
	},
	
	_getWorkIdProperty : function() {
		var hostName = window.location.hostname;
		if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) {
			return this._properties.workIdInTest;
		} else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) {
			return this._properties.workIdPublic;
		}
	},
	
	_getRankingWorkIdProperty : function() {
		var hostName = window.location.hostname;
		if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) {
			return this._properties.ranklistWorkIdTest;
		} else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) {
			return this._properties.ranklistWorkIdPublic;
		}
	},
	
	_getPlotingWorkIdProperty : function() {
		var hostName = window.location.hostname;
		if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) {
			return this._properties.plotingDataWorkIdTest;
		} else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) {
			return this._properties.plotingDataWorkIdPublic;
		}
	},
	
	_getTriplesByProperty : function(propName,currentList) {
		/*
          this function first will find the triple with the passed property and then
		  this will take the subject of it and will find other properties of that
          subject
		*/
		var filteredList = [];
		//var currentList = this._getCurrentUsingList();
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var prop = this._getProperty(triple.property);
			if (prop == propName) {
				filteredList.push(triple);
			}
		}
		return filteredList;
	},
	
	_getTriplesBySubject : function(subject) {
		var filteredList = [];
		var currentList = this._getCurrentUsingList();
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var triSubject = triple.subject;
			if (triSubject.trim() == subject.trim()) {
				filteredList.push(triple);
			}
			if (filteredList.length == this._fileProperties.length) {
				break;
			}
		}
		return filteredList;
	},
	
	// returns a string array
	_getDistinctObjectList : function(propName,currentList) {
		var distinctList = [];
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var prop = triple.property;
			if (prop && prop.indexOf(propName) != -1) {
				var objVal = triple.object;
				if (distinctList.indexOf(objVal) == -1) {
					distinctList.push(objVal);
				}
			}
		}
		return distinctList;
	},
	
	_getCurrentUsingList : function() {
		if (this._currentFilteredList.length == 0) {
			return this._fullList;
		} else {
			return this._currentFilteredList;
		}
	},
}
/*	
Application.baseLineSequence = function() {
	this._init.apply(this, arguments);
};

Application.baseLineSequence.prototype = {
	
	_attedSequenceInfo : null,
	_ppdbSequenceInfo : null,
	
	_default : {
		sequenceProperty : "baseline%20sequence"
	},
	
	_tag : {
		attedBaseSequenceTag : "atted_baseLineSequence",
		ppdbBaseSequenceTag : "ppdb_baseLineSequence"
	},
	
	_init : function() {
		this._attedSequenceInfo = {};
		this._ppdbSequenceInfo = {};
		this._initBaseSequenceFile();
	},
	
	_initBaseSequenceFile : function() {
		this._initAttedBaseSequenceFile();
		this._initPpdbBaseSequenceFile();
	},
	
	_initAttedBaseSequenceFile : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initAttedInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.attedBaseSequenceTag, getFilesByTag);
	},
	
	_initPpdbBaseSequenceFile : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initPpdbInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.ppdbBaseSequenceTag, getFilesByTag);
	},
	
	_initAttedInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._attedSequenceInfo.workId = workId;
					self._attedSequenceInfo.fileName = fileName;
					self._attedSequenceInfo.property = pValue;
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_initPpdbInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._ppdbSequenceInfo.workId = workId;
					self._ppdbSequenceInfo.fileName = fileName;
					self._ppdbSequenceInfo.property = pValue;
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getAttedSubjectUrl : function(gene) {
		return "http://atted.jp/data/locus/" + gene + ".html";
	},
	
	_getPpdbSubjectUrl : function(gene) {
		return "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene;
	},
	
	_getAttedBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._attedSequenceInfo.workId;
		var fileName = self._attedSequenceInfo.fileName;
		var property = self._attedSequenceInfo.property;
		var subject = self._getAttedSubjectUrl(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	},
	
	_getPpdbBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._ppdbSequenceInfo.workId;
		var fileName = self._ppdbSequenceInfo.fileName;
		var property = self._ppdbSequenceInfo.property;
		var subject = self._getPpdbSubjectUrl(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	},
	
	getBaseSequence : function(gene, geneType, callback) {
		var self = this;
		if ("ATTED" === geneType) {
			self._getAttedBaseSequence(gene, callback);
		} else if ("PPDB" === geneType) {
			self._getPpdbBaseSequence(gene, callback);
		} else {
			// error
		}
	}
};
*/
Application.baseLineSequence = function() {
	this._init.apply(this,arguments);
}
	
Application.baseLineSequence.prototype = {
	
	_baseLineSeqFileInfo : null,
	
	_default : {
		sequenceProperty : "promoter%20sequence",
		linkdataTestUrl : "test.linkdata.org",
		linkdatapublicUrl : "linkdata.org"
	},
	
	_tag : {
		baseSequenceTag : "promoter_sequence",
	},
	
	_init : function() {
		this._findBaseLineSequenceFile();
		this._baseLineSeqFileInfo = {};
	},
	
	_findBaseLineSequenceFile : function() {
		// looking one tagged file only
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initBaseLineSequenceFileInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.baseSequenceTag, getFilesByTag);
	},
	
	_initBaseLineSequenceFileInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._baseLineSeqFileInfo.workId = workId;
					self._baseLineSeqFileInfo.fileName = fileName;
					self._baseLineSeqFileInfo.property = pValue;
					return false;
				}
			});
		};
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getSubject : function(gene) {
		var hostName = window.location.hostname;
		var subject = null;
		gene = gene.toUpperCase();
		if (hostName.indexOf(this._default.linkdataTestUrl) != -1) {
			subject = this._default.linkdataTestUrl + "/resource/" + this._baseLineSeqFileInfo.workId + "#" + gene;
		} else if (hostName.indexOf(this._default.linkdatapublicUrl) != -1) {
			subject = this._default.linkdatapublicUrl + "/resource/" + this._baseLineSeqFileInfo.workId + "#" + gene;;
		}
		return "http://" + subject;
	},
	
	_getBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._baseLineSeqFileInfo.workId;
		var fileName = self._baseLineSeqFileInfo.fileName;
		var property = self._baseLineSeqFileInfo.property;
		var subject = self._getSubject(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	}
}

Application.tooltip = function() {
	this._init.apply(this, arguments);
};

Application.tooltip.prototype = {
	
	_toolTipList : null,
	
	_default : {
		explanationProperty : "explanation"
	},
	
	_init : function() {
		this._toolTipList = [];
		this._initToolTip();
	},
	
	_initToolTip : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._getFilePropertyList(workId, fileName);
				});
			});
		}
		LinkData.getFilesByTag(null, "tooltip", getFilesByTag);
	},
	
	_getFilePropertyList : function(workId, fileName) {
		var self = this;
		var index = new Application.index(1, 10000);
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				if (pValue.indexOf(self._default.explanationProperty) > -1) {
					self._getSubjectList(workId, fileName, pValue, index);
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getSubjectList : function(workId, fileName, property, index) {
		var self = this;
		var getSubjects = function(subjectList) {
			self._getPropertyList(subjectList, workId, fileName, property, index);
		}
		LinkData.getSubjects(workId, fileName, getSubjects, index);
	},
	
	_getPropertyList : function(subjectList, workId, fileName, property, index) {
		var self = this;
		var getTriplesByProperty = function(tripleList) {
			self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index);
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index);
	},
	
	_addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) {
		var self = this;
		for (var i = 0; i < subjectList.length; i++) {
			var key = self._getLabelAfterHash(subjectList[i]);
			if (tripleList[i]) {
				var value = tripleList[i].object;
				self._addToolTip(key, value);
			}
		}
		if (subjectList && subjectList.length == index.getItemCount()) {
			self._getSubjectList(workId, fileName, property, index.increment());
		}
	},
	
	_addToolTip : function(key, tooltip) {
		var obj = {};
		obj.key = key;
		obj.tooltip = tooltip;
		this._toolTipList.push(obj);
	},
	
	getByKey : function(key) {
		var self = this, tooltip;
		$.each(self._toolTipList, function(objKey, obj) {
			if (obj.key.toString().toLowerCase() === key.toString().toLowerCase()) {
				tooltip = obj.tooltip;
				return false;
			}
		});
		return (tooltip) ? tooltip : "";
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
};

Application.index = function() {
	this._init.apply(this, arguments);
}

Application.index.prototype = {
	
	_start : null,
	_end : null,
	
	_init : function(start, end) {
		this._start = start;
		this._end = end;
	},
	
	getIndex : function() {
		return {start : this._start, end : this._end};
	},
	
	getItemCount : function() {
		return (this._end - this._start + 1);
	},
	
	increment : function() {
		var itemCount = this.getItemCount();
		this._start = this._start + itemCount;
		this._end = this._end + itemCount;
		return {start : this._start, end : this._end};
	},
	
	getStartIndex : function() {
		return this._start;
	},
	
	getEndIndex : function() {
		return this._end;
	}
	
};

Application.timer = function() {
	this._init.apply(this, arguments);
};

Application.timer.prototype = {
	
	_delay : null,
	_retry : null,
	_maxRetry : null,
	
	_init : function() {
		this._delay = 1000;
		this._retry = 0;
		this._maxRetry = 100;
	},
	
	call : function(func) {
		if (this._retry < this._maxRetry) {
			setTimeout(func, this._delay);
		}
		this._retry++;
	},
	
	setMaxRetryCount : function(no) {
		this._maxRetry = no;
	}
};

Application.MotifConflication = function() {
	this._init.apply(this, arguments);
};

$(document).ready(function() {
	new Application.genocon();
});

body {
    font-family: sans-serif;
    font-size: 14px;
}

a {
    color: #3B5998;
    font-weight: bold;
    text-decoration: none;
}

#gcAppContainer {
	width: 900px;
}

.hidden {
	display:none;
}

.left {
    float: left;
}

.label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    min-width: 165px;
}

input.baseSequence {
	/*width: 100%;*/
}

.highlight-sequence {
	font-weight: bold;
}

.resultArea {
    font-family: "Courier New","Lucida Console";
    margin: 10px 0;
    min-width: 410px;
    overflow: auto;
    width: 100%;
	background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
	white-space: nowrap;
}

.resultArea .userSequence {
	white-space: nowrap;
	float: left;
}

.finishSequence,
.replaceSequenc {
   background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    margin: 10px 0 0;
	font-family: "Courier New","Lucida Console";
	width: 100%;
	overflow: auto;
	white-space: nowrap;
}

.wrappedSequenceMotif {
	background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    margin: 10px 0 0;
	font-family: "Courier New","Lucida Console";
	overflow: auto;
	word-wrap: break-word;
	white-space: normal;
	width:100%;
	height:90px;
	word-break: break-all;
}

.replace {
    color: #E80010;
}

.baseErrorMessage,
.errorMessage {
	color: black;
	/*text-align: center;*/
	margin-bottom: -10px;
    margin-top: 10px;
}

.errorText {
	color: #FF0000;
}

.applicationContainer {
    background-color: #F6F6F6;
    border: 1px solid #CCCCCC;
    margin: 5px 0 0;
    padding: 5px;
}

.actionButtonContainer {
    text-align: right;
}

.actionBtn {
    border: 1px solid #DDDDDD;
    cursor: pointer;
    display: inline-block;
    font-weight: bold;
    padding: 5px 2px;
    text-align: center;
    width: 25px;
}

.row {
    padding: 5px 0;
}
.row:after {
    clear: left;
    content: "";
    display: block;
}
.row input[type="text"] {
    width: 200px;
}

.row .externalLink {
	margin: 0 5px;
}

.noborder {
    border: medium none;
}

#baseSequenceContainer .baseSequenceBox {
	width: 100%;
	overflow: auto;
	white-space: nowrap;
}
#baseSequenceContainer .baseSequenceBox span,
#baseSequenceContainer .baseSequenceBox .baseSequence {
	font-family: Courier;
}

#baseSequenceContainer .baseSequenceBox .fixedSequence {
	position: relative;
	left: -6px;
	color: #AAAAAA;
	font-weight: bold;
}

.applicationContainer .nextButtonContainer {
	margin-top: 10px;
}

.databaseInfo .motif {
	width: 70%;
}

/**
 * button css
 */

a.useButton {
	width: 150px;
}

.actionBtn {
	border: 1px solid #DDDDDD;
    cursor: pointer;
    display: inline-block;
    font-weight: bold;
    padding: 5px 2px;
    text-align: center;
    width: 25px;
}

.actionBtn:hover {
	border: 1px solid #000000;
}

.btn {
  display: inline-block;
  *display: inline;
  /* IE7 inline-block hack */

*zoom: 1;
  padding: 4px 10px 4px;
  margin-bottom: 0;
  font-size: 13px;
  line-height: 18px;
  color: #333333;
  text-align: center;
  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);
  vertical-align: middle;
  background-color: #f5f5f5;
  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));
  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: linear-gradient(top, #ffffff, #e6e6e6);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);
  border-color: #e6e6e6 #e6e6e6 #bfbfbf;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
  border: 1px solid #cccccc;
  border-bottom-color: #b3b3b3;
  -webkit-border-radius: 4px;
  -moz-border-radius: 4px;
  border-radius: 4px;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  cursor: pointer;
  *margin-left: .3em;
}

.btn:hover,
.btn:active,
.btn.active,
.btn.disabled,
.btn[disabled] {
  background-color: #e6e6e6;
}

.btn:hover {
  color: #333333;
  text-decoration: none;
  background-color: #e6e6e6;
  background-position: 0 -15px;
  -webkit-transition: background-position 0.1s linear;
  -moz-transition: background-position 0.1s linear;
  -ms-transition: background-position 0.1s linear;
  -o-transition: background-position 0.1s linear;
  transition: background-position 0.1s linear;
}

.btn-blue,
.btn-blue:hover,
.btn-yellow,
.btn-yellow:hover,
.btn-red,
.btn-red:hover,
.btn-green,
.btn-green:hover,
.btn-lightblue,
.btn-lightblue:hover,
.btn-black,
.btn-black:hover {
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
  color: #ffffff;
}

.btn-blue {
  background-color: #0074cc;
  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);
  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));
  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);
  background-image: -o-linear-gradient(top, #0088cc, #0055cc);
  background-image: linear-gradient(top, #0088cc, #0055cc);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);
  border-color: #0055cc #0055cc #003580;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}

.btn-blue:hover,
.btn-blue:active,
.btn-blue.active,
.btn-blue.disabled,
.btn-blue[disabled] {
  background-color: #0055cc;
}

.btn-green {
  background-color: #5bb75b;
  background-image: -moz-linear-gradient(top, #62c462, #51a351);
  background-image: -ms-linear-gradient(top, #62c462, #51a351);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));
  background-image: -webkit-linear-gradient(top, #62c462, #51a351);
  background-image: -o-linear-gradient(top, #62c462, #51a351);
  background-image: linear-gradient(top, #62c462, #51a351);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);
  border-color: #51a351 #51a351 #387038;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-green:hover,
.btn-green:active,
.btn-green.active,
.btn-green.disabled,
.btn-green[disabled] {
  background-color: #51a351;
}
.btn-green:active,
.btn-green.active {
  background-color: #408140 ¥9;
}
.btn-lightblue {
  background-color: #49afcd;
  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));
  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: linear-gradient(top, #5bc0de, #2f96b4);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);
  border-color: #2f96b4 #2f96b4 #1f6377;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-lightblue:hover,
.btn-lightblue:active,
.btn-lightblue.active,
.btn-lightblue.disabled,
.btn-lightblue[disabled] {
  background-color: #2f96b4;
}

/* Dialog css */

.motifViewDialog .explanation {
	color: #AAAAAA;
	font-size: 12px;
	margin-left: 200px;
	margin-top : -10px;
}

.motifViewDialog .moreInfo {
	color: #3B5998;
	cursor: pointer;
}

.motifViewDialog .position {
	width: 70px;
}

.motifViewDialog .dialogErrorMessage {
	font-size: 12px;
}

.ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl {
    border-top-left-radius: 1px;
}
.ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr {
    border-top-right-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl {
    border-bottom-left-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br {
    border-bottom-right-radius: 1px;
}

.loadingImageContainer .loadingMessage {
	color: #FF0000;
}

.motifConflictionDialog .option {
	margin: 10px;
}

.motifViewDialog {
	margin-top: 10px;	
}

.motifViewDialog .label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    width : 200px;
}

.motifViewDialog .motifviewinfo {
	float: right;
    margin-top: -150px;
    position: relative;
    width: 350px;	
}

.deletelink {
	cursor: pointer;	
}

.deletelink img {
	margin-bottom: -3px;	
}

.manualMotifView .manualMotifViewInfo {
	float: right;
    height: 90px;
    margin-right: 10px;
    margin-top: -65px;
    position: relative;
    width: 380px;
}

.baseSequenceBox textarea {
	resize: none;	
	width: 490px;
	height: 115px;
}

.fixedSequenceCheckBox {
	float: right;
    margin-right: 210px;
    margin-top: -115px;
}

.fixedSequenceMsg {
	float: right;
    margin-right: 20px;
    margin-top: -40px;
}

.fixedSequenceMotif {
	display: inline;
    float: right;
    font-family: "Courier New","Lucida Console";
    margin-top: -15px;
}

.resultAreaUserMessageClass {
	color: #0A5DA6;
    font: bold 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    font-size: 12px;
    font-weight: bold;
    margin-top: -6px;
	margin-bottom: 4px;
}

.finishSequence {
	 background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    font-family: "Courier New","Lucida Console";
    height: 100px;
    margin: 10px 0 0;
    overflow: auto;
    width: 480px;
    word-break: break-all;
    word-wrap: break-word;
	white-space: normal;
}

.finishSequenceFixed {
	/*display: inline;
    float: right;
    font-family: "Courier New","Lucida Console";
    margin-top: -15px;*/
	display: inline;
    float: left;
    font-family: "Courier New","Lucida Console";
    margin-left: 488px;
    margin-top: -30px;
    overflow: auto;
    width: 400px;
	word-wrap: break-word;
}

.manualsequence {
	float: right;
    height: 40px;
    overflow: auto;
    width: 300px;
	margin-bottom: 5px;
}

.motifviewsequence {
	float: right;
    height: 40px;
    margin-bottom: 5px;
    overflow: auto;
    width: 240px;
}

div.warningTop {
	background-color:#F6F6F6;
	font-weight:bold;
	color:#223194;
}

.error {
	color:#ED4A68;
}

.loadingChart .loadChartMessage {
	color:#FF0000;
}

.loadingChart {
	text-align: center;
}

.bottomChartTitle {
    color: #0A5DA6;
    font: bold 12px "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
}

.finishSequenceMsg {
	color: #0A5DA6;
    float: right;
    font: bold 13px "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    margin-top: -80px;
    width: 400px;
}

<div id="tests"> </div>
<div class="warningTop">Hover mouse over menu items for tooltip descriptions</div>
</br>
<div id="gcAppContainer">

<div id="baseSequenceContainer">
	<div class="label baseSequenceLabel">Base Sequence</div>
	<div class="baseSequenceBox">
		<span>
			<textarea type="text" cols=45 rows=5 class="baseSequence" value="" disabled=true maxlength=500> </textarea>
		</span>
		
		<span class="fixedSequence">GATCCCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG</span>
		
		<div>
			<div class="fixedSequenceCheckBox"><input type="checkbox" id="chkEmptySequnce" value="true" checked=true>Start with empty sequence</div>
			<div class="fixedSequenceMsg">Minimal Promoter (fixed)</div>
		</div>
	</div>
	<div style="margin-top:5px;"><a class="useButton btn btn-green">Start promoter design</a></div>
	<div class="baseErrorMessage hidden"></div>
</div>
<div class="baseSequenceError hidden error">
	Warning: Motif contains nonstandard characters for DNA design. All characters except A, T, C, G will be treated as unique special characters. Currently IUPAC codes are not supported.
</div>
<div class="applicationContainer hidden">
	<div class="actionButtonContainer">
		<span class="appSummery"></span>
		<span class="collapseButton actionBtn" title="collapse">_</span>
		<span class="expandButton actionBtn" title="expand">+</span>
		<span class="removeButton actionBtn" title="remove">x</span>
		<br clear="all"/>
	</div>
	<div class="applicationDataContainer">
		
		<div class="row">
			<div class="label left optionListLabel">Select Tool</div>
			<div class="left">
				<select class="optionList"></select>
				
			</div>
		</div>

<div class="row hidden analysisMethodContainer">
			<div class="label left analysisMethodLabel">Analysis Method</div>
			<div class="left">
				<select class="analysisMethod"></select>
			</div>
		</div>
		
		<div class="row hidden expressionDbContainer">
			<div class="label left expressionDbLabel">Expression DataBase</div>
			<div class="left">
				<select class="expressionDb"></select>
			</div>
		</div>
		
		<div class="row hidden dataColContainer">
			<div class="label left dataColLabel">Data Collection</div>
			<div class="left">
				<select class="dataCol"></select>
			</div>
		</div>
		
		<div class="actionResultContainer"></div>
		<div class="nextButtonContainer hidden">
			<a class="btn nextButton">Next</a>
			<a class="btn repeatAgain">Repeat settings</a>
			<a class="btn finishNow">Finish Now</a>
		</div>
		<div class="finishSequenceContainer hidden">
			<div class="finishSequence"></div>
			<div class="finishSequenceMsg">Fixed minimal promoter sequence from -1 to -50 before the transcription start site, from CaMV35S promoter.</div>
			<div class="finishSequenceFixed"></div>
		</div>
	</div>
</div>
</div>

Select Input Data

LinkData Work	Table Data
Circadian Genomic (DIURNAL + PPDB promoter motif) normalized	DiurnalHours_PPDB_COL_LDHH_normalize DiurnalHours_PPDB_COL_SD_normalize DiurnalHours_PPDB_DD_DDHC_normalize DiurnalHours_PPDB_LDHC_normalize DiurnalHours_PPDB_LDHH_SM_normalize DiurnalHours_PPDB_LDHH_ST_normalize DiurnalHours_PPDB_LER_SD_normalize DiurnalHours_PPDB_LIGHT5_HIF138_13_normalize DiurnalHours_PPDB_LIGHT5_HIF138_8_normalize DiurnalHours_PPDB_LIGHT5_znknOX_normalize DiurnalHours_PPDB_LL12_LDHH_normalize DiurnalHours_PPDB_LL23_LDHH_normalize DiurnalHours_PPDB_LLHC_normalize DiurnalHours_PPDB_LL_LDHC_normalize DiurnalHours_PPDB_LL_LLHC_normalize DiurnalHours_PPDB_lhyox_SD_normalize DiurnalHours_PPDB_longday_normalize DiurnalHours_PPDB_lux_2_LDHH_normalize DiurnalHours_PPDB_phyB9_SD_normalize DiurnalHours_PPDB_shortday_normalize
PromoterCAD Data Tables	PromoterCAD_Data_Tables
Rank Lists of Diurnal PPDB	DiurnalHours_PPDB_GeneRank_for_MotifCircadian_all DiurnalHours_PPDB_all
Rank Lists of AtGenExpress mean gene expression + PLACE promoter motif	AtGenExpress_PLACE_mean_all
Developmental Genomic (AtGenExpress Developmental gene expression + PPDB promoter motif) Triplicate Data	AtGenExpress_PPDB_Flowering AtGenExpress_PPDB_Fruit_Seeds AtGenExpress_PPDB_Leaf AtGenExpress_PPDB_Root AtGenExpress_PPDB_Seedling AtGenExpress_PPDB_Stem AtGenExpress_PPDB_Whole_Plant
DIURNAL normalized gene expression + PLACE promoter motif	DiurnalHours_PLACE_COL_LDHH_normalize DiurnalHours_PLACE_COL_SD_normalize DiurnalHours_PLACE_DD_DDHC_normalize DiurnalHours_PLACE_LDHC_normalize DiurnalHours_PLACE_LDHH_SM_normalize DiurnalHours_PLACE_LDHH_ST_normalize DiurnalHours_PLACE_LER_SD_normalize DiurnalHours_PLACE_LIGHT5_HIF138_13_normalize DiurnalHours_PLACE_LIGHT5_HIF138_8_normalize DiurnalHours_PLACE_LIGHT5_znknOX_normalize DiurnalHours_PLACE_LL12_LDHH_normalize DiurnalHours_PLACE_LL23_LDHH_normalize DiurnalHours_PLACE_LLHC_normalize DiurnalHours_PLACE_LL_LDHC_normalize DiurnalHours_PLACE_LL_LLHC_normalize DiurnalHours_PLACE_lhyox_SD_normalize DiurnalHours_PLACE_longday_normalize DiurnalHours_PLACE_lux_2_LDHH_normalize DiurnalHours_PLACE_phyB9_SD_normalize DiurnalHours_PLACE_shortday_normalize
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) normalized	AtGenExpress_ATTED_Flowering_normalize AtGenExpress_ATTED_Fruit_Seeds_normalize AtGenExpress_ATTED_Leaf_normalize AtGenExpress_ATTED_Root_normalize AtGenExpress_ATTED_Seedling_normalize AtGenExpress_ATTED_Stem_normalize AtGenExpress_ATTED_Whole_Plant_normalize
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) mean	AtGenExpress_ATTED_Flowering_mean AtGenExpress_ATTED_Fruit_Seeds_mean AtGenExpress_ATTED_Leaf_mean AtGenExpress_ATTED_Root_mean AtGenExpress_ATTED_Seedling_mean AtGenExpress_ATTED_Stem_mean AtGenExpress_ATTED_Whole_Plant_mean
PromoterCAD plugin tools	PromoterCAD_plugins
Developmental Genomic (AtGenExpress + PPDB promoter motif) mean	AtGenExpress_PPDB_Flowering_mean AtGenExpress_PPDB_Fruit_Seeds_mean AtGenExpress_PPDB_Leaf_mean AtGenExpress_PPDB_Root_mean AtGenExpress_PPDB_Seedling_mean AtGenExpress_PPDB_Stem_mean AtGenExpress_PPDB_Whole_Plant_mean
Developmental Genomic (AtGenExpress + PPDB promoter motif) normalized	AtGenExpress_PPDB_Flowering_normalize AtGenExpress_PPDB_Fruit_Seeds_normalize AtGenExpress_PPDB_Leaf_normalize AtGenExpress_PPDB_Root_normalize AtGenExpress_PPDB_Seedling_normalize AtGenExpress_PPDB_Stem_normalize AtGenExpress_PPDB_Whole_Plant_normalize
AtGenExpress normalized gene expression + PLACE promoter motif	AtGenExpress_PLACE_Flowering_normalize AtGenExpress_PLACE_Fruit_Seeds_normalize AtGenExpress_PLACE_Leaf_normalize AtGenExpress_PLACE_Root_normalize AtGenExpress_PLACE_Seedling_normalize AtGenExpress_PLACE_Stem_normalize AtGenExpress_PLACE_Whole_Plant_normalize
PromoterCAD Beginning Tutorial 1 - Tooltip Information	tooltip_AtGenExpress tooltip_DataTable tooltip_PromoterCAD_menus_buttons
Rank List of AtGenExpress ATTED mean	AtGenExpress_ATTED_mean_all
PromoterCAD_links	External_Links
Circadian Genomic (DIURNAL + PPDB promoter motif)	DiurnalHours_PPDB_COL_LDHH DiurnalHours_PPDB_COL_SD DiurnalHours_PPDB_DD_DDHC DiurnalHours_PPDB_LDHC DiurnalHours_PPDB_LDHH_SM DiurnalHours_PPDB_LDHH_ST DiurnalHours_PPDB_LER_SD DiurnalHours_PPDB_LIGHT5_HIF138_13 DiurnalHours_PPDB_LIGHT5_HIF138_8 DiurnalHours_PPDB_LIGHT5_znknOX DiurnalHours_PPDB_LL12_LDHH DiurnalHours_PPDB_LL23_LDHH DiurnalHours_PPDB_LLHC DiurnalHours_PPDB_LL_LDHC DiurnalHours_PPDB_LL_LLHC DiurnalHours_PPDB_lhyox_SD DiurnalHours_PPDB_longday DiurnalHours_PPDB_lux_2_LDHH DiurnalHours_PPDB_phyB9_SD DiurnalHours_PPDB_shortday
Rank Lists of Diurnal PPDB normalize	DiurnalHours_PPDB_normalize_GeneRank_for_MotifCircadian_all DiurnalHours_PPDB_normalize_all
Arabidopsis promoter sequence	arabidopsis_promoter_sequence
Rank Lists of DIURNAL normalized gene expression + PLACE promoter motif	DiurnalHours_PLACE_normalize_GeneRank_for_MotifCircadian_all DiurnalHours_PLACE_normalize_all_1st DiurnalHours_PLACE_normalize_all_2nd
Rank Lists of AtGenExpress median gene expression + PLACE promoter motif	AtGenExpress_PLACE_all
Circadian Coexpression (DIURNAL + ATTED-II promoter motif)	DiurnalHours_ATTED_COL_LDHH DiurnalHours_ATTED_COL_SD DiurnalHours_ATTED_DD_DDHC DiurnalHours_ATTED_LDHC DiurnalHours_ATTED_LDHH_SM DiurnalHours_ATTED_LDHH_ST DiurnalHours_ATTED_LER_SD DiurnalHours_ATTED_LIGHT5_HIF138_13 DiurnalHours_ATTED_LIGHT5_HIF138_8 DiurnalHours_ATTED_LIGHT5_znknOX DiurnalHours_ATTED_LL12_LDHH DiurnalHours_ATTED_LL23_LDHH DiurnalHours_ATTED_LLHC DiurnalHours_ATTED_LL_LDHC DiurnalHours_ATTED_LL_LLHC DiurnalHours_ATTED_lhyox_SD DiurnalHours_ATTED_longday DiurnalHours_ATTED_lux_2_LDHH DiurnalHours_ATTED_phyB9_SD DiurnalHours_ATTED_shortday
DIURNAL gene expression + PLACE promoter motif	DiurnalHours_PLACE_COL_LDHH DiurnalHours_PLACE_COL_SD DiurnalHours_PLACE_DD_DDHC DiurnalHours_PLACE_LDHC DiurnalHours_PLACE_LDHH_SM DiurnalHours_PLACE_LDHH_ST DiurnalHours_PLACE_LER_SD DiurnalHours_PLACE_LIGHT5_HIF138_13 DiurnalHours_PLACE_LIGHT5_HIF138_8 DiurnalHours_PLACE_LIGHT5_znknOX DiurnalHours_PLACE_LL12_LDHH DiurnalHours_PLACE_LL23_LDHH DiurnalHours_PLACE_LLHC DiurnalHours_PLACE_LL_LDHC DiurnalHours_PLACE_LL_LLHC DiurnalHours_PLACE_lhyox_SD DiurnalHours_PLACE_longday DiurnalHours_PLACE_lux_2_LDHH DiurnalHours_PLACE_phyB9_SD DiurnalHours_PLACE_shortday
Rank Lists of AtGenExpress ATTED normalize	AtGenExpress_ATTED_normalize_all
Rank Lists of AtGenExpress normalized gene expression + PLACE promoter motif	AtGenExpress_PLACE_normalize_all
Rank Lists of AtGenExpress PPDB normalize	AtGenExpress_PPDB_normalize_all
Circadian Coexpression (DIURNAL + ATTED-II promoter motif) normalized	DiurnalHours_ATTED_COL_LDHH_normalize DiurnalHours_ATTED_COL_SD_normalize DiurnalHours_ATTED_DD_DDHC_normalize DiurnalHours_ATTED_LDHC_normalize DiurnalHours_ATTED_LDHH_SM_normalize DiurnalHours_ATTED_LDHH_ST_normalize DiurnalHours_ATTED_LER_SD_normalize DiurnalHours_ATTED_LIGHT5_HIF138_13_normalize DiurnalHours_ATTED_LIGHT5_HIF138_8_normalize DiurnalHours_ATTED_LIGHT5_znknOX_normalize DiurnalHours_ATTED_LL12_LDHH_normalize DiurnalHours_ATTED_LL23_LDHH_normalize DiurnalHours_ATTED_LLHC_normalize DiurnalHours_ATTED_LL_LDHC_normalize DiurnalHours_ATTED_LL_LLHC_normalize DiurnalHours_ATTED_lhyox_SD_normalize DiurnalHours_ATTED_longday_normalize DiurnalHours_ATTED_lux_2_LDHH_normalize DiurnalHours_ATTED_phyB9_SD_normalize DiurnalHours_ATTED_recalculation_COL_SD_normalize DiurnalHours_ATTED_shortday_normalize
Rank Lists of AtGenExpress PPDB	AtGenExpress_PPDB_all
Rank Lists of Diurnal ATTED	DiurnalHours_ATTED_GeneRank_for_MotifCircadian_all DiurnalHours_ATTED_all
Developmental Coexpression (AtGenExpress gene expression + ATTED-II promoter motif) median	AtGenExpress_ATTED_Flowering_median AtGenExpress_ATTED_Fruit_Seeds_median AtGenExpress_ATTED_Leaf_median AtGenExpress_ATTED_Root_median AtGenExpress_ATTED_Seedling_median AtGenExpress_ATTED_Stem_median AtGenExpress_ATTED_Whole_Plant_median Heptamer_elements
AtGenExpress mean gene expression + PLACE promoter motif	AtGenExpress_PLACE_Flowering_mean AtGenExpress_PLACE_Fruit_Seeds_mean AtGenExpress_PLACE_Leaf_mean AtGenExpress_PLACE_Root_mean AtGenExpress_PLACE_Seedling_mean AtGenExpress_PLACE_Stem_mean AtGenExpress_PLACE_Whole_Plant_mean
Rank List of AtGenExpress PPDB mean	AtGenExpress_PPDB_mean_all
Rank Lists of AtGenExpress ATTED	AtGenExpress_ATTED_all
Developmental Coexpression (AtGenExpress Developmental gene expression + ATTED-II promoter motif) Triplicate Data	AtGenExpress_ATTED_Flowering AtGenExpress_ATTED_Fruit_Seeds AtGenExpress_ATTED_Leaf AtGenExpress_ATTED_Root AtGenExpress_ATTED_Seedling AtGenExpress_ATTED_Stem AtGenExpress_ATTED_Whole_Plant
AtGenExpress gene expression + PLACE promoter motif Triplicate Data	AtGenExpress_PLACE_Flowering AtGenExpress_PLACE_Fruit_Seeds AtGenExpress_PLACE_Leaf AtGenExpress_PLACE_Root AtGenExpress_PLACE_Seedling AtGenExpress_PLACE_Stem AtGenExpress_PLACE_Whole_Plant
Developmental Genomic (AtGenExpress + PPDB promoter motif) median	AtGenExpress_PPDB_Flowering_median AtGenExpress_PPDB_Fruit_Seeds_median AtGenExpress_PPDB_Leaf_median AtGenExpress_PPDB_Root_median AtGenExpress_PPDB_Seedling_median AtGenExpress_PPDB_Stem_median AtGenExpress_PPDB_Whole_Plant_median Octamer_elements
Rank Lists of Diurnal ATTED normalize	DiurnalHours_ATTED_normalize_GeneRank_for_MotifCircadian_all DiurnalHours_ATTED_normalize_all
AtGenExpress median gene expression + PLACE promoter motif	AtGenExpress_PLACE_Flowering_median AtGenExpress_PLACE_Fruit_Seeds_median AtGenExpress_PLACE_Leaf_median AtGenExpress_PLACE_Root_median AtGenExpress_PLACE_Seedling_median AtGenExpress_PLACE_Stem_median AtGenExpress_PLACE_Whole_Plant_median
Rank Lists of DIURNAL gene expression + PLACE promoter motif	DiurnalHours_PLACE_GeneRank_for_MotifCircadian_all DiurnalHours_PLACE_all

Add LinkData work(LinkData)

<h3>Tooltip</h3>

<p>
To facilitate the usability of PromoterCAD, we provide the tooltip informartion.
Then it is easy for users to undergo the promoter motif manipulation.
<br>
<br>
Hover the cursor to the items such as the button "Start promoter design",
and the PromoterCAD returns the messsage<br>
"Start your promoter design with the empty sequence in the region -51 to -550 from the transcriptional start site."
<br>
<br>
Then users can start their promoter design by clicking the button.
</p>

</td>
<td>

</td>
</tr>
</tbody>
</table>

<h3>Basic Usage</h3>

<p>
To execute the synthetic promoter design using the PromoterCAD, please go through the following workflow basically.
</p>

<table>
<tbody>
<tr valign="top">
<td width="50%">

</td>
<td>

<ol>
<li>
At first, with the menu "Select tool", users can select one of the functions for performing
a particular data operation. For example, the function "MotifMaxExpress" finds
motifs associated with maximum gene expression in a specific condition.
Select this function to find motifs associated with strong expression in flower tissues.
</li>
<li>
With the menu "Analysis Method", users can select a regulatory motif data set (ATTED/PPDB) registered in LinkData.
</li>
<li>
With the menu "Expression Database", users can select microarray expression database (AtGenExpress/DIURNAL) registered in LinkData.
Data containing the developmental series from AtGeneExpress has been split into a series of data tables by tissue type,
and those from DIURNAL has been split into a a series of data tables by circadian growth condition.
</li>
<li>
With the menu "Data Collection", users can select the data tables corresponding to the interesting developmental/circadian condition.
(e.g. "Flowering")
</li>
<li>
The next menu "Select Property", users can select one of the expression conditions
associated with the database. For the AtGenExpress data, this is represented by a
shorthand description. For example, "Col-0_flower" refers to the Columbia strain 0,
grown for 4 weeks until the flowering stage. The gene expression levels are for the
entire flower.
<br>
The full description of each experiment can be referenced on the TAIR website. For
example, flowering experiments are described here:<br>
<a href="http://arabidopsis.org/servlets/TairObject?type=bio_sample_collection&id=1006710
873#437">http://arabidopsis.org/servlets/TairObject?type=bio_sample_collection&id=1006710
873#437</a>
<br>
Select a particular experiment and MotifExpress will find known sequence
motifs associated with high expression in this condition. MotifMaxExpress will
automatically display these motif sequences (in this case septamers) in line with the
base promoter sequence at the same location as they occur in the promoter returned
by MotifExpress.
</li>
<li>
By clicking the button "Add motif", all the selected motifs are incorporated into the promoter motif skelton. The result will be displayed in the text area
 with the motifs indicated by color.
</li>
<li>
Click the button "Next", to repeat the sequence design operation and continue the
workflow. (Continues the steps 1-6.)
</li>
<li>
In the final step, click the button "Finish Now" to  fill in the skeleton (the 'bones' of the promoter, containing just regulatory motifs and the minimal promoter region) with the remaining sequence.
This will replace the blank '-' sequences, but will preserve any motifs added in the design process.
</li>
</ol>

</td>
</tr>
</tbody>
</table>

<h3>Tutorials</h3>

<p>
Here are tutorials to execute synthetic promoter designs using PromoterCAD. These have example walk throughs with snapshots for each step.
</p>
<table>

<tbody>
<tr valign="top">
<td>
<a target="_blank" href="https://hackpad.com/fvol30isGPL#PromoterCAD-Beginning-Tutorial-1">
Beginning_Tutorials_1
</a>
</td>
<td>
This tutorial illustrates how to design a synthetic promoter for Leaf specific expression using the MotifExpress tool.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/oNrS0K21sgd#PromoterCAD-Beginning-Tutorial-2:-Design-a-promoter-for-Circadian-expression-with-MotifCircadian">
Beginning_Tutorials_2
</a>
</td>
<td>
This tutorial illustrates how to design a synthetic promoter for Circadian expression with MotifCircadian tool.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/dAL1Omja3Mi#PromoterCAD-Beginning-Tutorial-3:-Use-InputMotif-to-add-specific-motifs-to-a-gene-design">
Beginning_Tutorials_3
</a>
</td>
<td>
This tutorial illustrates how to use InputMotif tool to add specific motifs to a gene design.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/4b72OO5mXOa#Advanced-Tutorial-1:-How-to-fork-your-own-PromoterCAD-workspace-and-make-workflow-snapshots">
Advanced_Tutorials_1
</a>
</td>
<td>
This tutorial illustrates how to fork your own PromoterCAD workspace.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/sxhIWdJ8Qix#Advanced-Tutorial-2A:-add-a-new-database-(normalized-data)-to-PromoterCAD">
Advanced_Tutorials_2A
</a>
</td>
<td>
This tutorial illustrates how to add a new normalized data to PromoterCAD.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/IWlEhmJ2jfT#Advanced-Tutorial-2B:-add-a-new-database-(PLACE-motif-data)-to-PromoterCAD">
Advanced_Tutorials_2B
</a>
</td>
<td>
This tutorial illustrates how to add a new database PLACE motif data to PromoterCAD.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/SLPqFU0AiLn#Advanced-Tutorial-3A:-Add-a-new-gene-expression-mining-plugin-to-PromoterCAD-(MotifRanking)">
Advanced_Tutorials_3A
</a>
</td>
<td>
This tutorial illustrates how to add a new data mining plugin tool MotifRanking.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/fzxSQrVTkdB#Advanced-Tutorial-3B:-Add-a-new-data-mining-plugin-to-PromoterCAD-(MotifNonCircadian)">
Advanced_Tutorials_3B
</a>
</td>
<td>
This tutorial illustrates how to add a new data mining plugin tool MotifNonCircadian.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/Advanced-Tutorial-4-cJ1VVvUtp1W">
Advanced_Tutorials_4
</a>
</td>
<td>
This tutorial illustrates how to modify and upload your own tooltips.
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/Help-Page-Interpreting-PromoterCAD-Output-VnHPootms0p">
Help Page
</a>
</td>
<td>
Interpreting PromoterCAD Output 
</td>
</tr>

<tr>
<td>
<a target="_blank" href="https://hackpad.com/Help-Page-How-to-tag-input-LinkData-tables-for-PromoterCAD-3WwOXIeohDL">
Help Page
</a>
</td>
<td>
How to tag input LinkData tables for PromoterCAD 
</td>
</tr>

</tbody>
</table>

<h3>License</h3>
<p>
PromoterCAD source code is licensed under  <a href="http://opensource.org/licenses/LGPL-3.0">the LGPL-3.0 license (the GNU Lesser General Public License, version 3.0)</a> and <a href="http://creativecommons.org/licenses/by-sa/3.0/deed.en">the Creative Commons license CC-BY-SA</a>.
So users can fork the source code of PromoterCAD to easily create their own data mining plugins. 
<br>
<a href="http://creativecommons.org/licenses/by-sa/3.0/deed.en">
<img src="http://app.linkdata.org/asset/8c72b4fc.png" width="20%">
</a>

</p>

Click the Browse button or drag and drop to choose files to upload

The Maximum upload size is 1MB.(bmp,gif,jpeg,jpg,png)

Edit Application

Please enter information for the application to be registered.

*Required field

Account Name

Application Name*: Remove; Add name for another language

Collaborators

Image: You can upload jpg, gif, png file formats

Website: x

Add website

Tag

License

API version

Initial Cost: ￥

Annual Cost: ￥

Description: Tutorials for this application:<br> <a href="https://hackpad.com/PromoterCAD-Beginning-Tutorial-1-fvol30isGPL"> Beginning Tutorial 1: Design a synthetic promoter for Leaf specific expression using the MotifExpress tool </a> <br> <a href="https://hackpad.com/Advanced-Tutorial-4-cJ1VVvUtp1W"> Advanced Tutorial 4: Modify and upload your own tooltips </a> <br> <br> <strong> License </strong> <p> The source code for this application is now licensed under <a href="http://opensource.org/licenses/LGPL-3.0">the LGPL-3.0 license (the GNU Lesser General Public License, version 3.0)</a> and <a href="http://creativecommons.org/licenses/by-sa/3.0/deed.en">the Creative Commons license CC-BY-SA</a>, which allows for unlimited reuse and modification of the source code. Users can select either one of the licenses LGPL-3.0 and CC-BY-SA, when using the source code. Any users can access the source code of this application as follows. <br> <a href="http://app.linkdata.org/update/app1s343i"> http://app.linkdata.org/update/app1s343i</a> </p> Remove; Add description for another language