PromoterCAD Beginning Tutorial 1 - example application

Tutorials for this application:
Beginning Tutorial 1: Design a synthetic promoter for Leaf specific expression using the MotifExpress tool
Advanced Tutorial 4: Modify and upload your own tooltips

License

The source code for this application is now licensed under the LGPL-3.0 license (the GNU Lesser General Public License, version 3.0) and the Creative Commons license CC-BY-SA, which allows for unlimited reuse and modification of the source code. Users can select either one of the licenses LGPL-3.0 and CC-BY-SA, when using the source code. Any users can access the source code of this application as follows.
http://app.linkdata.org/update/app1s343i

Rating

useful

Application

Play
JavaScript
CSS
HTML
ReadMe
Snapshots

if (typeof Application == "undefined" || !Application) {
	var Application = {};
}

Application.genocon = function() {
	this._init.apply(this, arguments);
};

Application.genocon.prototype = {
	
	CHAR_SEQ_EMPTY : "-",
	
	_baseSequence : null,
	_tooltip : null,
	_methodList : null,
	_appBaseLineSequence : null,
	_appMenuHandler : null,
	_validCharcters : ['A','T','C','G','-'],
	
	_default : {
		baseSequenceContainerId : "baseSequenceContainer",
		fixedSequenceClass : "fixedSequence",
		finishSequence : "finishSequence",
		finishSequenceContainer : "finishSequenceContainer",
		baseErrorMessageClass : "baseErrorMessage",
		errorMessageEnterSequence : "Please enter a sequence of minimum length {0}",
		errorMessageMaximumSequence : "Please enter a sequence of maximum length {0}",
		useButtonClass : "useButton",
		nextButtonClass : "nextButton",
		finishNowButtonClass : "finishNow",
		nextButtonContainerClass : "nextButtonContainer",
		collapseButton : "collapseButton",
		expandButton : "expandButton",
		removeButton : "removeButton",
		appContainerClass : "applicationContainer",
		appDataContainerClass : "applicationDataContainer",
		actionButtonContainer : "actionButtonContainer",
		actionResultContainer : "actionResultContainer",
		baseSequenceBoxClass : "baseSequenceBox",
		baseSequenceClass : "baseSequence",
		selectDataBaseList : "databaseList",
		selectMethodList : "optionList",
		databaseFilteringProperty : "#motif%20sequence",
		methodUrlProperty : "#application%20URL",
		baseSequenceMinLength : 50,
		baseSequenceMaxLength : 500,
		//applicationOptionClass : "applicationOptionRadio",
		analysisMethodComboClass : "analysisMethod",
		expressionDbComboClass : "expressionDb",
		dataColomboClass : "dataCol",
		analysisMethodContainer : "analysisMethodContainer",
		expressionDbContainer : "expressionDbContainer",
		dataColContainer : "dataColContainer",
		chkEmptySequenceId : "chkEmptySequnce",
		analysisMethodComboEmptyOptionText : "-- Select Analysis Method --",
		expressionDbComboEmptyOptionText : "-- Select Expression Database --",
		dataColColomboEmptyOptionText : "-- Select Data Collection --",
		manualMotifEntryToolName : "InputMotif",
		itemLabelPostfix : "Label",
		finishSequenceFixedClass : "finishSequenceFixed",
		repeatButtonClass : "repeatAgain",
		baseSequenceErrDivClass : "baseSequenceError"
	},
	
	_tag : {
		databaseTag : "database",
		methodTag : "method"
	},
	
	_tooltipName : {
		atGeneExpress : "atgenexpress",
		diurnal : "diurnal",
		selectDatabase : "selectdatabase",
		selectTool : "Select Tool",
		motifExpress : "motifexpress",
		motifCircatian : "motifcircadian",
		motifRank : "motifranking",
		motifQuery : "motifquery",
		inputMotif : "inputmotif",
		defaultSequence : "Base Sequence",
		fixedSequence : "gacccttcctctatataaggaagttcatttcatttggagaggacctcgac",
		finishNow : "Finish Now",
		next : "Next",
		expressionDb : "Expression Database",
		analysisMethod : "Analysis Method",
		dataCollection : "Data Collection",
		baseSequence : "Base Sequence",
		finishNow : "Finish Now",
		startButton : "Start"
	},
	
	_init : function() {
		this._methodList = [];
		this._initToolTip();
		this._initDefaultSequence();
		this._initAppBaseLineSequence();
		this._initLoadScript();
		this._initUseButtonListener();
		this._initAppMenuHanndler();
		this._initAnalysisMethodListener();
		this._initExpressionDbListener();
		this._initDataCollectionListener();
		this._initEmptySequenceCheckBox();
	},
	
	_initToolTip : function() {
		this._tooltip = new Application.tooltip();
	},
	
	_initEmptySequenceCheckBox : function() {
		var self = this;
		$("#" + this._default.chkEmptySequenceId).click(function() {
			if ($(this).is(":checked")) {
				var textArea = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass)
				$(textArea).attr("value","");
				self._fillEmptyBaseSequence();
				$(textArea).attr("disabled",true);
				$("div." + self._default.baseSequenceErrDivClass).hide();
			} else {
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",false);
			}
		});
		/* following two lines were added to correct the behaviour, if user just pressed F5 button to 
           refresh the browser. in that case if previously checkbox is unnchecked, even after pressing
           F5, it remains unchecked in the new window
        */
		$("#" + this._default.chkEmptySequenceId).attr("checked","checked");
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",true);
	},
	
	_initDefaultSequence : function() {
		var self = this;
		this._fillEmptyBaseSequence();
		$baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass);
		$baseInput.attr("value",$baseInput.val());
		$baseInput.keyup(function() {
			$baseInput.attr("value", $baseInput.val());
		});
		$("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceBoxClass).scrollLeft(10000);
		var timer = new Application.timer();
		var applyToolTip = function() {
			var dToolTip = self._getToolTip(self._tooltipName.defaultSequence);
			var fToolTip = self._getToolTip(self._tooltipName.fixedSequence);
			var toolToolTip = self._getToolTip(self._tooltipName.selectTool);
			var analysisCmbToolTip = self._getToolTip(self._tooltipName.analysisMethod);
			var expDbToolTip = self._getToolTip(self._tooltipName.expressionDb);
			var dataCollToolTip = self._getToolTip(self._tooltipName.dataCollection);
			var startButToolTip = self._getToolTip(self._tooltipName.startButton);
			if (dToolTip && fToolTip) {
				var labelPostfix = self._default.itemLabelPostfix;
				//$("#tests").html(dataCollToolTip);
				//$("#tests").attr("title",$("#tests").html());
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("title", dToolTip);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass + labelPostfix).attr("title", dToolTip);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).attr("title", fToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass).attr("title", analysisCmbToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass + labelPostfix).attr("title", analysisCmbToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass).attr("title", expDbToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass + labelPostfix).attr("title", expDbToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.dataColomboClass).attr("title", dataCollToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.dataColomboClass + labelPostfix).attr("title", dataCollToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.selectMethodList).attr("title", toolToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.selectMethodList + labelPostfix).attr("title", toolToolTip);
				
				$(" ." + self._default.useButtonClass).attr("title", startButToolTip);
			} else {
				timer.call(applyToolTip);
			}
		}
		applyToolTip();
	},
	
	_initAppBaseLineSequence : function() {
		this._appBaseLineSequence = new Application.baseLineSequence();
	},
	
	_initAppMenuHanndler : function() {
		this._appMenuHandler = new Application.MenuHandler()
	},
	
	_initLoadScript : function() {
		var self = this;
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileArray){
				$.each(fileArray, function(fileKey, fileName) {
					var getProperties = function(propertytList) {
						$.each(propertytList, function(propKey, propVal) {
							if (propVal.indexOf(self._default.methodUrlProperty) > -1) {
								self._loadPluginScriptList(workId, fileName, propVal);
								return false;
							}
						});
					}
					LinkData.getProperties(workId, fileName, getProperties);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag);
	},
	
	_initDefaultContainer : function() {
		this._initMethod();
		this._initActionButton();
		this._initMethodListener();
	},
	
	_initMethod : function() {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$("option", $select).remove();
		$select.append("<option value='-1' selected='selected'>-- Select Tool --</option>");
		$select.attr("title", self._getToolTip(self._tooltipName.selectTool));
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileArray){
				$.each(fileArray, function(fileKey, fileName) {
					var getSubjects = function(subjectList) {
						$.each(subjectList, function(subKey, subVal) {
							var label = self._getLabel(subVal);
							var tooltip = self._getToolTipByToolName(label);
							tooltip = (tooltip) ? tooltip : "";
							$select.append("<option value='" + label + "' title='" + tooltip + "'>" + label + "</option>");
							self._methodList.push(label);
						});
					}
					LinkData.getSubjects(workId, fileName, getSubjects);
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag);
	},
	
	_initActionButton : function() {
		var self = this;
		$("." + self._default.actionButtonContainer + " ." + self._default.collapseButton).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.appDataContainerClass).hide();
		});
		$("." + self._default.actionButtonContainer + " ." + self._default.expandButton).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.appDataContainerClass).show();
		});
		$("." + self._default.actionButtonContainer + " ." + self._default.removeButton).click(function() {
			if ($("." + self._default.appContainerClass).length == 1) {
				$("." + self._default.appContainerClass).hide();
				$("." + self._default.appContainerClass + " .actionResultContainer").html("");
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).show();
			} else {
				$(this).closest("." + self._default.appContainerClass).remove();
			}
		});
	},
	
	_scrollDown : function() {
		$("html, body").animate({ scrollTop: $(document).height() }, 1000);
	},
	
	// tool listner
	_initMethodListener : function() {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$select.change(function() {
			var selectedTool = $(this).val();
			if (selectedTool != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				if (selectedTool == self._default.manualMotifEntryToolName) {
					//$(parent).find("." + self._default.applicationOptionClass).hide();
					self._showSelectedPlugin(null,$(this));
				} else {
					//self._clearWorkingArea(this);
					//self._initMotifExpressOptions(this);
					self._fillAnalysisMethodCombo(this);
					$(parent).find("." + self._default.analysisMethodContainer).show();
				}
				self._resetDataMiningCombos(this);
				self._scrollDown();
			}
		});
	},
	
	_makeTheDomChangeOfComboSelect : function(comboSelecter, value) {
		$(comboSelecter + " option").each(function(i){
        	var optionVal = $(this).val();
			if (optionVal == value) {
				$(this).attr("selected",true);
			}
    	});
	},
	
	_initAnalysisMethodListener : function() {
		var self = this;
		var selecter = "." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass;
		var $select = $(selecter);
		$select.change(function() {
			var selectedAnalysisMethod = $(this).val();
			if (selectedAnalysisMethod != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				self._fillExpressionDBCombo(this);
				self._resetDataMiningCombos(this);
				$(parent).find("." + self._default.expressionDbContainer).show();
				self._scrollDown();
			}
		});
	},
	
	_initExpressionDbListener : function() {
		var self = this;
		var selector = "." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass
		var $select = $(selector);
		$select.change(function() {
			var selectedExpressionDb = $(this).val();
			if (selectedExpressionDb != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				self._fillDataCollectionCombo(this);
				self._resetDataMiningCombos(this);
				$(parent).find("." + self._default.dataColContainer).show();
				self._scrollDown();
			}
		});
	},
	
	_initDataCollectionListener : function() {
		var self = this;
		var selector = "." + self._default.appContainerClass + " ." + self._default.dataColomboClass;
		var $select = $(selector);
		$select.change(function() {
			var selectedDataCollection = $(this).val();
			if (selectedDataCollection != "-1") {
				self._showSelectedPlugin(selectedDataCollection,$(this));
				self._scrollDown();
			}
		});
	},
	
	_getSelectedTool : function(parentRef) {
		return $(parentRef).find("." + this._default.selectMethodList).val();
	},
	
	_getSelectedAnalysisMethod : function(parentRef) {
		var comboRef = $(parentRef).find("." + this._default.analysisMethodComboClass);
		if (comboRef.length > 0 && comboRef.is(":visible")) {
			return $(comboRef).val();
		} else {
			return "";
		}
	},
	/*
	_initMotifExpressOptions : function(context) {
		var self = this;
		var parent = $(context).closest("." + this._default.appContainerClass);
		//$(parent).find("." + self._default.applicationOptionClass).unbind('click');
		var selectedTool = $(context).val();
		if (selectedTool == "MotifExpress") {
			$(parent).find("." + self._default.applicationOptionClass).show();
			$(parent).find("." + self._default.applicationOptionClass).click(function() {
				var selectedDataCollection = $(parent).find("." + self._default.dataColomboClass);
				if ($(selectedDataCollection).is(":visible") && $(selectedDataCollection).val() != "-1") {
					self._showSelectedPlugin(selectedDataCollection.val(),$(this));
					//return;
				}	
			});
			// making motif max as the defaukt mthod
			$(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked")[0].checked=true;
		} else {
			$(parent).find("." + self._default.applicationOptionClass).hide();
		}
	},*/
	
	_resetDataMiningCombos : function(comboRef) {
		var parent = $(comboRef).closest("." + this._default.appContainerClass);
		var expressionDbContainer = $(parent).find("." + this._default.expressionDbContainer);
		var dataColContainer = $(parent).find(" ." + this._default.dataColContainer);
		var analysisMethodContainer = $(parent).find(" ." + this._default.analysisMethodContainer);
		var toolCombo = $(parent).find("." + this._default.selectMethodList);
		var comboClass = $(comboRef).attr("class");
		if (toolCombo.val() == this._default.manualMotifEntryToolName) {
			$(analysisMethodContainer).hide();
			$(expressionDbContainer).hide();
			$(dataColContainer).hide();
		} else {
			if (comboClass == this._default.selectMethodList) {
				$(analysisMethodContainer).show();
				$(expressionDbContainer).hide();
				$(dataColContainer).hide();
			} else if (comboClass == this._default.analysisMethodComboClass) {
				$(expressionDbContainer).hide();
				$(dataColContainer).hide();
			}
			$container = $(parent).find("." + this._default.actionResultContainer);
			$container.html("");
		}
		$(parent).find("." + this._default.finishSequenceContainer).hide()
		this._scrollDown();
		//$(parent).find("." + this._default.finishSequenceFixedClass).hide();
	},
	
	_showSelectedPlugin : function(selectedDataCollection,context) {
		var self = this;
		var info = null;
		if (selectedDataCollection) {
			info = this._appMenuHandler._getSelectedDbInfoUsingDataCollection(selectedDataCollection);
		}
		var parent = $(context).closest("." + this._default.appContainerClass);
		var method = $(parent).find("." + self._default.selectMethodList).val();
		var analysisMethod = $(parent).find("." + self._default.analysisMethodComboClass).val();
		$container = $(parent).find("." + self._default.actionResultContainer);
		$container.html("Loading...");
		//$(parent).find("." + this._default.applicationOptionClass).hide();
		$(parent).find("." + this._default.nextButtonContainerClass).hide();
		var date = new Date();
		var id = "container_id_" + date.getTime();
		//var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val();
		var fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).html();
		$container.attr("id", id);
		var func = function() {
			self._callback(parent, self);
		}
		var obj = {
			workId : (info) ? info.workId : "",
			fileName : (info) ? info.fileName : "",
			rankListWorkId : (info) ? info.rankListWorkId : "",
			plotingWorkId : (info) ? info.plotingWorkId : "",
			baseSequence : self._baseSequence,
			tooltip : self._tooltip,
			callback : func,
			//applicationOption : appOption,
			fixedSequence : fixedSeq,
			motifMethod : this._getSelectedAnalysisMethod(parent),
			dataColl : selectedDataCollection,
			analysisMethod : analysisMethod
		};
		
		eval(method)(id, obj);
		self._scrollDown();
	},
	
	_fillAnalysisMethodCombo : function(selectToolCmbRef) {
		var parent = $(selectToolCmbRef).closest("." + this._default.appContainerClass);
		var selectedTool = $(selectToolCmbRef).val();
		var analysisMethods = this._appMenuHandler._getFilteredDistinctAnalysisMethods(selectedTool);
		var analysisMethodCmb = $(parent).find("." + this._default.analysisMethodComboClass);
		this._fillCombo(analysisMethods, analysisMethodCmb, this._default.analysisMethodComboEmptyOptionText, this._tooltipName.analysisMethod);
	},
	
	_fillExpressionDBCombo : function(analysisMethodCmbRef) {
		var parent = $(analysisMethodCmbRef).closest("." + this._default.appContainerClass);
		var selectedTool = this._getSelectedTool(parent);
		var selectedAnalysisMethod = $(analysisMethodCmbRef).val();
		var expressionDbs = this._appMenuHandler._getFilteredDistinctExpressionDbs(selectedTool,selectedAnalysisMethod);
		var analysisMethodCmb = $(parent).find("." + this._default.expressionDbComboClass);
		this._fillCombo(expressionDbs, analysisMethodCmb, this._default.expressionDbComboEmptyOptionText, this._tooltipName.expressionDb);
	},
	
	_fillDataCollectionCombo : function(expressionDbRef) {
		var parent = $(expressionDbRef).closest("." + this._default.appContainerClass);
		var selectedTool = this._getSelectedTool(parent);
		var selectedAnalysisMethod = this._getSelectedAnalysisMethod(parent);
		var selectedExpressionDb = $(expressionDbRef).val();
		var dataCollections = this._appMenuHandler._getFilteredDistinctDataCollections(selectedTool,selectedAnalysisMethod,selectedExpressionDb);
		var dataColCmb = $(parent).find("." + this._default.dataColomboClass);
		this._fillCombo(dataCollections, dataColCmb, this._default.dataColColomboEmptyOptionText, this._tooltipName.dataCollection);
	},
		
	_fillCombo : function(optionsArr, cmbRef, firstOptionText, firstOptionToolTipKey) {
		$(cmbRef).empty();
		var toolTip = this._tooltip.getByKey(firstOptionToolTipKey);
		$(cmbRef).append("<option value='-1' title='"+ toolTip +"'>"+ firstOptionText +"</option>");
		for (var index = 0 ; index < optionsArr.length ; index++) {
			var option = optionsArr[index];
			toolTip = this._tooltip.getByKey(option);
			$(cmbRef).append("<option value='"+ option + "' title='"+ toolTip +"'>"+ option +"</option>");
		}	
	},

_fillEmptyBaseSequence : function() {
		var self = this, sb = [];
		for (var i = 0; i < self._default.baseSequenceMaxLength; i++) {
			sb[sb.length] = self.CHAR_SEQ_EMPTY;
		}
		$baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass);
		$baseInput.val(sb.join(""));
	},
	
	_loadPluginScriptList : function(workId, fileName, property) {
		var getTripleList = function(tripleList) {
			$.each(tripleList, function(tKey, tVal) {
				LinkDataUtil.loadScript(tVal.object);
			});
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTripleList);
	},
	
	_changeMethodList : function(dbKey) {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$select.attr("title", self._getToolTip(self._tooltipName.selectTool));
		$("option", $select).remove();
		$select.append("<option value='-1' selected='selected'>-- Select Tool --</option>");
		if (dbKey == -1) {
			return;
		}
		var arr = dbKey.split("|");
		var workId = arr[0];
		var fileName = arr[1];
		$.each(self._methodList, function(key, method) {
			self._addValidMethod($select, workId, fileName, method);
		});
	},
	
	_addValidMethod : function($select, workId, fileName, method) {
		var self = this;
		var getFilesByTag = function(fileList) {
			if (!fileList) {
				return;
			}
			$.each(fileList, function(fKey, fName) {
				if (fName === fileName) {
					var tooltip = self._getToolTipByToolName(method);
					tooltip = (tooltip) ? tooltip : "";
					$select.append("<option value='" + method + "' title='" + tooltip + "'>" + method + "</option>");
					return false;
				}
			});
		}
		LinkData.getFilesByTag(workId, method, getFilesByTag);
	},
	
	_initUseButtonListener : function() {
		var self = this;
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).click(function() {
			self._initDefaultContainer();
			$txtSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass);
			$fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass);
			self._hideError();
			if ($txtSeq.val().length > self._default.baseSequenceMaxLength) {
				self._showError(self._default.errorMessageMaximumSequence.replace("{0}", self._default.baseSequenceMaxLength));
				return;
			}
			self._showWarningForNonStandardCharsIfExists();
			if ($txtSeq.val().length < self._default.baseSequenceMaxLength) {
				var tmpVal = $txtSeq.val();
				var eVal = self._getExtraDefaultSequence(self._default.baseSequenceMaxLength - $txtSeq.val().length);
				$txtSeq.val(eVal + tmpVal);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("size", 500);
			}
			self._baseSequence = $txtSeq.val().toString().toLowerCase() + $fixedSeq.html();
			if (!self._baseSequence || self._baseSequence.length < self._default.baseSequenceMinLength) {
				self._showError(self._default.errorMessageEnterSequence.replace("{0}", self._default.baseSequenceMinLength));
			} else {
				//$txtSeq.attr('readonly', true).addClass("noborder");
				$(this).hide();
				$("." + self._default.appContainerClass).show();
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbContainer).hide();
		    	$("." + self._default.appContainerClass + " ." + self._default.dataColContainer).hide();
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodContainer).hide();
				$("." + self._default.appContainerClass + " ." + self._default.nextButtonContainerClass).hide();
				$("." + self._default.appContainerClass + " ." + self._default.finishSequenceContainer).hide()
			}
		});
	},
	
	_showWarningForNonStandardCharsIfExists : function() {
		var found = false;
		var txtSeq = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass).val();
		for (var i = 0 ; i < txtSeq.length ; i++) {
			var char = txtSeq.charAt(i).toString().toUpperCase();
			if (this._validCharcters.indexOf(char) == -1) {
				$("div." + this._default.baseSequenceErrDivClass).show();
				found = true;
				break;
			}
		}
		if (found == false) {
			$("div." + this._default.baseSequenceErrDivClass).hide();
		}
	},
	
	_callback : function(parent, self) {
		if (self._isSelectedManualMotif(parent)) {
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).hide();
			$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).hide();
			//self._initNextButtonListener();
		} else {
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).show();
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).attr("title", self._getToolTip(self._tooltipName.finishNow));
			$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).show();
			self._initFinishNowButtonListener();
		}
		$(parent).find("." + self._default.nextButtonContainerClass).show();
		$(parent).find("." + self._default.finishSequenceContainer).hide();
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).attr("title", self._getToolTip(self._tooltipName.next));
		$(parent).find("." + self._default.nextButtonContainerClass).show();
		self._initNextButtonListener();
		self._initRepeatButtonListner();
	},
	
	_isSelectedManualMotif : function(parent) {
		var toolCombo = $(parent).find("." + this._default.selectMethodList);
		var selectedTool = toolCombo.val();
		if (selectedTool == this._default.manualMotifEntryToolName) {
			return true;
		} else {
			return false;
		}
	},
	
	_initNextButtonListener : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).click(function() {
			$parent = $(this).closest("." + self._default.appContainerClass);
			$parent.find("." + self._default.nextButtonContainerClass).hide();
			$($parent).find("." + self._default.finishSequenceContainer).hide()
			var clone = $parent.clone(true);
			//$(clone).find("." + self._default.applicationOptionClass).hide();
			var text = $(clone).find(".replaceSequence").text();
			if (text && text.trim().length != 0) {
				self._baseSequence = text;
			}
			$(clone).find("." + self._default.actionResultContainer).html("");
			$(clone).find("." + self._default.nextButtonContainerClass).hide();
			$(clone).find("." + self._default.expressionDbContainer).hide();
		    $(clone).find(" ." + self._default.dataColContainer).hide();
			$(clone).find(" ." + self._default.analysisMethodContainer).hide();
			$parent.parent().append(clone);
			self._scrollDown();
		});
	},
	
	_initFinishNowButtonListener : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.nextButtonContainerClass).hide();
			$(parent).find("." + self._default.finishSequenceContainer).hide()
			var gene = $(parent).find(".replaceSequence .gene").val();
			var geneType = $(parent).find(".replaceSequence .geneType").val();
			if (gene && geneType) {
				var callback = function(bSequence) {
					self._showFinishedBaseSequence(parent, bSequence);
				}
				//self._appBaseLineSequence.getBaseSequence(gene, geneType, callback);
				self._appBaseLineSequence._getBaseSequence(gene, callback);
			} else {
				self._showFinishedBaseSequence(parent,self._baseSequence);
			}
			self._scrollDown();
		});
	},
	
	_initRepeatButtonListner : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).click(function() {
			$parent = $(this).closest("." + self._default.appContainerClass);
			$parent.find("." + self._default.nextButtonContainerClass).hide();
			$($parent).find("." + self._default.finishSequenceContainer).hide()
			var clone = $parent.clone(true);
			var text = $(clone).find(".replaceSequence").text();
			if (text && text.trim().length != 0) {
				self._baseSequence = text;
			}
			$(clone).find("." + self._default.actionResultContainer).html("");
			$(clone).find("." + self._default.nextButtonContainerClass).hide();
			// setting the values
			var tool = $($parent).find("." + self._default.selectMethodList).val();	
			var expressionDb = $($parent).find("." + self._default.expressionDbComboClass).val();
			//var dataCollection = $($parent).find("." + self._default.dataColomboClass).val();
			var analysisMethod = $($parent).find("." + self._default.analysisMethodComboClass).val();
			$(clone).find("." + self._default.selectMethodList).val(tool);
			$(clone).find("." + self._default.expressionDbComboClass).val(expressionDb);
		    //$(clone).find(" ." + self._default.dataColomboClass).val(dataCollection);
			$(clone).find(" ." + self._default.analysisMethodComboClass).val(analysisMethod);
			$parent.parent().append(clone);
			self._scrollDown();
		});
	},
	
	_showFinishedBaseSequence : function(parent, bSequence) {
		var self = this;
		var defaultSequence = $(parent).find(".replaceSequence").text()
		$(parent).find(".wrappedSequenceMotif").hide();	
		var html = self._getFinishedBaseSequence(defaultSequence, bSequence);
		var fixedSequence = self._getFixedSequence();
		$(parent).find("." + self._default.finishSequenceContainer).show();
		$(parent).find("." + self._default.finishSequenceFixedClass).html(fixedSequence);
		//$(parent).find("." + self._default.finishSequenceFixedClass).show();
		$(parent).find("." + self._default.finishSequence).html(html);
		$(parent).find("." + self._default.finishSequence).scrollLeft(10000);
	},
	
	_getFixedSequence : function() {
		var fixedSequence = $("#" + this._default.baseSequenceContainerId + " ." + this._default.fixedSequenceClass).html();
		return fixedSequence;
	},
	
	_getFinishedBaseSequence : function(defaultSequence, bSequence) {
		var self = this, sb = [];
		var fixedSequence = this._getFixedSequence();
		var uptoFixedSequence = defaultSequence.length - fixedSequence.length;
		for (var i = 0; i < defaultSequence.length; i++) {
			if (i > uptoFixedSequence - 1) {
				continue;
			}
			var dChar = defaultSequence.charAt(i);
			var bChar = bSequence.charAt(i);
			if (bChar) {
				if (dChar !== self.CHAR_SEQ_EMPTY) {
					sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>";
				} else {
					sb[sb.length] = bChar.toLowerCase();
				}
			} else {
				sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>";
			}
		}
		return sb.join("");
	},
	
	_getExtraDefaultSequence : function(count) {
		var self = this, sb = [];
		for (var i = 0; i < count; i++) {
			sb[sb.length] = self.CHAR_SEQ_EMPTY;
		}
		return sb.join("");
	},
	
	_getDatabaseOptionKey : function(workId, fileName) {
		return workId + "|" + fileName;
	},
	
	_getLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_showError : function(message) {
		var self = this;
		$errMsgEl = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass);
		$errMsgEl.html(message);
		$errMsgEl.show();
	},
	
	_hideError : function() {
		var self = this;
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass).hide();
	},
	
	_getToolTipByFileName : function(fileName) {
		var self = this;
		if (fileName) {
			if (fileName.toLowerCase().indexOf(self._tooltipName.atGeneExpress) > -1) {
				return self._getToolTip(self._tooltipName.atGeneExpress);
			} else if (fileName.toLowerCase().indexOf(self._tooltipName.diunal) > -1) {
				return self._getToolTip(self._tooltipName.diunal);
			}
		}
	},
	
	_getToolTipByToolName : function(tool) {
		var self = this;
		if (tool) {
			if (tool.toLowerCase().indexOf(self._tooltipName.motifExpress) > -1) {
				return self._getToolTip(self._tooltipName.motifExpress);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifCircatian) > -1) {
				return self._getToolTip(self._tooltipName.motifCircatian);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifRank) > -1) {
				return self._getToolTip(self._tooltipName.motifRank);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifQuery) > -1) {
				return self._getToolTip(self._tooltipName.motifQuery);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.inputMotif) > -1) {
				return self._getToolTip(self._tooltipName.inputMotif);
			}
		}
	},
	
	_getToolTip : function(key) {
		return this._tooltip.getByKey(key);
	}
	
};

Application.MenuHandler = function() {
	this._init.apply(this,arguments);
}

Application.MenuHandler.prototype = {
	
	_fullList : [],
	_currentFilteredList : [],
	_workId : null,
	_fileName : null,
	_fileProperties : null,
	
	_properties : {
		motifAnalysisMethod : "motif%20analysis%20method",
		geneExpressionData : "gene%20expression%20data",
		menuDisplayName : "menu%20display%20name",
		toolsList : "tool%20list",
		workIdInTest : "test.linkdata.org",
		workIdPublic : "linkdata.org",
		ranklistWorkIdTest : "rank%20list%20test.linkdata.org",
		ranklistWorkIdPublic : "rank%20list%20linkdata.org",
		plotingDataWorkIdTest :"plot%20in%20test.linkdata.org",
		plotingDataWorkIdPublic :"plot%20in%20linkdata.org"
    },
	
	_tags : {
		menuDataSourceTag : "menu"
	},
	
	_defaults : {
		linkdataTestUrl : "test.linkdata.org",
		linkdataPublicUrl : "linkdata.org",
	},
	
	_init : function(args) {
		this._initMenuDataSource();
	},
	
	_fillFileProperties : function() {
		var self = this;
		var setProperties = function(props) {
			self._fileProperties = props;
		};
		LinkData.getProperties(this._workId,this._fileName,setProperties);
	},
	
	_initMenuDataSource : function() {
		var self = this;
		var foundMenuFiles = [];
		var loadMenuFiles = function(resultList) {
			$.each(resultList, function(wId, fileList) {
				$.each(fileList, function(fileKey, fName) {
					var obj = {
						workId : wId,
						fileName : fName
					};
					foundMenuFiles.push(obj);
				});
			});
			self._foundMenuFiles = foundMenuFiles;
			self._loadMenuFileContent(foundMenuFiles);
			self._fillFileProperties();
		};
		LinkData.getFilesByTag(null, this._tags.menuDataSourceTag, loadMenuFiles);
	},
	
	_loadMenuFileContent : function(menuFiles) {
		var self = this;
		var addFileContent = function(triples) {
			for (var index = 0 ; index < triples.length ; index++) {
				self._fullList.push(triples[index]);
			}
		};
		if (menuFiles.length > 1) {
			alert("There can be only one file that can be tagged with 'menu'");
			return;
		}
		if (menuFiles.length == 0) {
			return;
		}
		var obj = menuFiles.shift(); // removing the first element
		this._fileName = obj.fileName;
		this._workId = obj.workId;
		LinkData.getTriples(this._workId,this._fileName,addFileContent,{start:1, end:2000});
	},
	
	
	_getFilteredAnalysisMethodTriples : function(toolName) {
		if (!(toolName)) return this._fullList;
		this._currentFilteredList = [];
		var listByTool = this._getTriplesByProperty(this._properties.toolsList,this._fullList);
		if (!listByTool) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByTool.length ; index++) {
			var triple = listByTool[index];
			if (triple.object) {
				var toolList = triple.object.split(",");
				for (var index1 = 0 ; index1 < toolList.length ; index1++) {
					var tool = toolList[index1];
					if (tool.trim() == toolName.trim()) {
						var subject = triple.subject;
						var otherPropTripleList = this._getTriplesBySubject(subject);
						for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
							var propTriple = otherPropTripleList[index1];
							//this._currentFilteredList.push(propTriple);
							filteredList.push(propTriple);
						}
						break;
					}
				}
			}
		}
	    return filteredList;
	},
	
	_getFilteredDistinctAnalysisMethods : function(toolName) {
		var filteredList = this._getFilteredAnalysisMethodTriples(toolName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.motifAnalysisMethod,filteredList);
		return distinctList;
	},
		
	_getFilteredExpressionDbTriples : function(toolName,analysisMethodName) {
		var listByTool = this._getFilteredAnalysisMethodTriples(toolName);
		var listByAnalysisMethod = this._getTriplesByProperty(this._properties.motifAnalysisMethod,listByTool);
		if (!listByAnalysisMethod) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByAnalysisMethod.length ; index++) {
			var triple = listByAnalysisMethod[index];
			if (triple.object) {
				var analysisMethod = triple.object;
				if (analysisMethod.trim() == analysisMethodName.trim()) {
					var subject = triple.subject;
					var otherPropTripleList = this._getTriplesBySubject(subject);
					for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
						var propTriple = otherPropTripleList[index1];
						//this._currentFilteredList.push(propTriple);
						filteredList.push(propTriple);
					}
				}
			}
		}
		return filteredList
	},
	
	_getFilteredDistinctExpressionDbs : function(toolName,analysisMethodName) {
		var filteredList = this._getFilteredExpressionDbTriples(toolName,analysisMethodName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.geneExpressionData,filteredList);
		return distinctList;
	},
		
	_getFilteredDataCollectionTriples : function(toolName,analysisMethodName,expressionDbName) {
		var listByExpDbs = this._getFilteredExpressionDbTriples(toolName,analysisMethodName);
		var listByGeneExp = this._getTriplesByProperty(this._properties.geneExpressionData,listByExpDbs);
		if (!listByGeneExp) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByGeneExp.length ; index++) {
			var triple = listByGeneExp[index];
			if (triple.object) {
				var exprssionDb = triple.object;
				if (exprssionDb.trim() == expressionDbName.trim()) {
					var subject = triple.subject;
					var otherPropTripleList = this._getTriplesBySubject(subject);
					for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
						var propTriple = otherPropTripleList[index1];
						//this._currentFilteredList.push(propTriple);
						filteredList.push(propTriple);
					}
				}
			}
		}
		return filteredList;
	},
		
	_getFilteredDistinctDataCollections : function(toolName,analysisMethodName,expressionDbName) {
		var filteredList = this._getFilteredDataCollectionTriples(toolName,analysisMethodName,expressionDbName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.menuDisplayName,filteredList);
		return distinctList;
	},
	
	_getSelectedDbInfoUsingDataCollection : function(dataCollectionName) {
		var matchingList = [];
		var outObj = null;
		var listByDataCollection = this._getTriplesByProperty(this._properties.menuDisplayName,this._currentFilteredList);
		if (!listByDataCollection) return null;
		for (var index = 0 ; index < listByDataCollection.length ; index++) {
			var triple = listByDataCollection[index];
			var dataCollection = triple.object;
			if (dataCollection == dataCollectionName) {
				matchingList.push(triple);
			}
		}
		if (matchingList.length > 1) {
			// this a error. because there can be only one matching triple
			alert("Data file error");
		} else {
			// getting other triples for found one
			var subject = matchingList.shift().subject;
			var workId, rankWorkId, plotingWorkId = null;
			var otherPropTripleList = this._getTriplesBySubject(subject);
			var workIdProperty = this._getWorkIdProperty();
			var rankWorkIdProp = this._getRankingWorkIdProperty();
			var plotingWorkIdProp = this._getPlotingWorkIdProperty();
			for (var index=0 ; index < otherPropTripleList.length ; index++) {
				var triple = otherPropTripleList[index];
				var prop = this._getProperty(triple.property);
				if (workIdProperty == prop) {
					workId = triple.object;
				}
				if (rankWorkIdProp == prop) {
					rankWorkId = triple.object;
				}
				if (plotingWorkIdProp == prop) {
					plotingWorkId = triple.object;
				}
				if (workId && rankWorkId && plotingWorkId) {
					break;
				}
			}
			var workIdComps = workId.split("/");
			var rankWorkIdComps = rankWorkId.split("/");
			var plotingWorkIdComps = plotingWorkId.split("/");
			var subjectComps = subject.split("#");
			outObj = {
				fileName : subjectComps[subjectComps.length-1],
				workId : workIdComps[workIdComps.length-1],
				rankListWorkId : rankWorkIdComps[rankWorkIdComps.length-1],
				plotingWorkId : plotingWorkIdComps[plotingWorkIdComps.length-1]
			};
		}
		return outObj;
	},
	
	_getProperty : function(propertyUrl) {
		var comps = propertyUrl.split("#");
		return comps[comps.length-1];
	},
	
	_getWorkIdProperty : function() {
		var hostName = window.location.hostname;
		if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) {
			return this._properties.workIdInTest;
		} else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) {
			return this._properties.workIdPublic;
		}
	},
	
	_getRankingWorkIdProperty : function() {
		var hostName = window.location.hostname;
		if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) {
			return this._properties.ranklistWorkIdTest;
		} else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) {
			return this._properties.ranklistWorkIdPublic;
		}
	},
	
	_getPlotingWorkIdProperty : function() {
		var hostName = window.location.hostname;
		if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) {
			return this._properties.plotingDataWorkIdTest;
		} else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) {
			return this._properties.plotingDataWorkIdPublic;
		}
	},
	
	_getTriplesByProperty : function(propName,currentList) {
		/*
          this function first will find the triple with the passed property and then
		  this will take the subject of it and will find other properties of that
          subject
		*/
		var filteredList = [];
		//var currentList = this._getCurrentUsingList();
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var prop = this._getProperty(triple.property);
			if (prop == propName) {
				filteredList.push(triple);
			}
		}
		return filteredList;
	},
	
	_getTriplesBySubject : function(subject) {
		var filteredList = [];
		var currentList = this._getCurrentUsingList();
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var triSubject = triple.subject;
			if (triSubject.trim() == subject.trim()) {
				filteredList.push(triple);
			}
			if (filteredList.length == this._fileProperties.length) {
				break;
			}
		}
		return filteredList;
	},
	
	// returns a string array
	_getDistinctObjectList : function(propName,currentList) {
		var distinctList = [];
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var prop = triple.property;
			if (prop && prop.indexOf(propName) != -1) {
				var objVal = triple.object;
				if (distinctList.indexOf(objVal) == -1) {
					distinctList.push(objVal);
				}
			}
		}
		return distinctList;
	},
	
	_getCurrentUsingList : function() {
		if (this._currentFilteredList.length == 0) {
			return this._fullList;
		} else {
			return this._currentFilteredList;
		}
	},
}
/*	
Application.baseLineSequence = function() {
	this._init.apply(this, arguments);
};

Application.baseLineSequence.prototype = {
	
	_attedSequenceInfo : null,
	_ppdbSequenceInfo : null,
	
	_default : {
		sequenceProperty : "baseline%20sequence"
	},
	
	_tag : {
		attedBaseSequenceTag : "atted_baseLineSequence",
		ppdbBaseSequenceTag : "ppdb_baseLineSequence"
	},
	
	_init : function() {
		this._attedSequenceInfo = {};
		this._ppdbSequenceInfo = {};
		this._initBaseSequenceFile();
	},
	
	_initBaseSequenceFile : function() {
		this._initAttedBaseSequenceFile();
		this._initPpdbBaseSequenceFile();
	},
	
	_initAttedBaseSequenceFile : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initAttedInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.attedBaseSequenceTag, getFilesByTag);
	},
	
	_initPpdbBaseSequenceFile : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initPpdbInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.ppdbBaseSequenceTag, getFilesByTag);
	},
	
	_initAttedInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._attedSequenceInfo.workId = workId;
					self._attedSequenceInfo.fileName = fileName;
					self._attedSequenceInfo.property = pValue;
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_initPpdbInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._ppdbSequenceInfo.workId = workId;
					self._ppdbSequenceInfo.fileName = fileName;
					self._ppdbSequenceInfo.property = pValue;
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getAttedSubjectUrl : function(gene) {
		return "http://atted.jp/data/locus/" + gene + ".html";
	},
	
	_getPpdbSubjectUrl : function(gene) {
		return "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene;
	},
	
	_getAttedBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._attedSequenceInfo.workId;
		var fileName = self._attedSequenceInfo.fileName;
		var property = self._attedSequenceInfo.property;
		var subject = self._getAttedSubjectUrl(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	},
	
	_getPpdbBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._ppdbSequenceInfo.workId;
		var fileName = self._ppdbSequenceInfo.fileName;
		var property = self._ppdbSequenceInfo.property;
		var subject = self._getPpdbSubjectUrl(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	},
	
	getBaseSequence : function(gene, geneType, callback) {
		var self = this;
		if ("ATTED" === geneType) {
			self._getAttedBaseSequence(gene, callback);
		} else if ("PPDB" === geneType) {
			self._getPpdbBaseSequence(gene, callback);
		} else {
			// error
		}
	}
};
*/
Application.baseLineSequence = function() {
	this._init.apply(this,arguments);
}
	
Application.baseLineSequence.prototype = {
	
	_baseLineSeqFileInfo : null,
	
	_default : {
		sequenceProperty : "promoter%20sequence",
		linkdataTestUrl : "test.linkdata.org",
		linkdatapublicUrl : "linkdata.org"
	},
	
	_tag : {
		baseSequenceTag : "promoter_sequence",
	},
	
	_init : function() {
		this._findBaseLineSequenceFile();
		this._baseLineSeqFileInfo = {};
	},
	
	_findBaseLineSequenceFile : function() {
		// looking one tagged file only
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initBaseLineSequenceFileInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.baseSequenceTag, getFilesByTag);
	},
	
	_initBaseLineSequenceFileInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._baseLineSeqFileInfo.workId = workId;
					self._baseLineSeqFileInfo.fileName = fileName;
					self._baseLineSeqFileInfo.property = pValue;
					return false;
				}
			});
		};
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getSubject : function(gene) {
		var hostName = window.location.hostname;
		var subject = null;
		gene = gene.toUpperCase();
		if (hostName.indexOf(this._default.linkdataTestUrl) != -1) {
			subject = this._default.linkdataTestUrl + "/resource/" + this._baseLineSeqFileInfo.workId + "#" + gene;
		} else if (hostName.indexOf(this._default.linkdatapublicUrl) != -1) {
			subject = this._default.linkdatapublicUrl + "/resource/" + this._baseLineSeqFileInfo.workId + "#" + gene;;
		}
		return "http://" + subject;
	},
	
	_getBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._baseLineSeqFileInfo.workId;
		var fileName = self._baseLineSeqFileInfo.fileName;
		var property = self._baseLineSeqFileInfo.property;
		var subject = self._getSubject(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	}
}

Application.tooltip = function() {
	this._init.apply(this, arguments);
};

Application.tooltip.prototype = {
	
	_toolTipList : null,
	
	_default : {
		explanationProperty : "explanation"
	},
	
	_init : function() {
		this._toolTipList = [];
		this._initToolTip();
	},
	
	_initToolTip : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._getFilePropertyList(workId, fileName);
				});
			});
		}
		LinkData.getFilesByTag(null, "tooltip", getFilesByTag);
	},
	
	_getFilePropertyList : function(workId, fileName) {
		var self = this;
		var index = new Application.index(1, 10000);
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				if (pValue.indexOf(self._default.explanationProperty) > -1) {
					self._getSubjectList(workId, fileName, pValue, index);
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getSubjectList : function(workId, fileName, property, index) {
		var self = this;
		var getSubjects = function(subjectList) {
			self._getPropertyList(subjectList, workId, fileName, property, index);
		}
		LinkData.getSubjects(workId, fileName, getSubjects, index);
	},
	
	_getPropertyList : function(subjectList, workId, fileName, property, index) {
		var self = this;
		var getTriplesByProperty = function(tripleList) {
			self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index);
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index);
	},
	
	_addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) {
		var self = this;
		for (var i = 0; i < subjectList.length; i++) {
			var key = self._getLabelAfterHash(subjectList[i]);
			if (tripleList[i]) {
				var value = tripleList[i].object;
				self._addToolTip(key, value);
			}
		}
		if (subjectList && subjectList.length == index.getItemCount()) {
			self._getSubjectList(workId, fileName, property, index.increment());
		}
	},
	
	_addToolTip : function(key, tooltip) {
		var obj = {};
		obj.key = key;
		obj.tooltip = tooltip;
		this._toolTipList.push(obj);
	},
	
	getByKey : function(key) {
		var self = this, tooltip;
		$.each(self._toolTipList, function(objKey, obj) {
			if (obj.key.toString().toLowerCase() === key.toString().toLowerCase()) {
				tooltip = obj.tooltip;
				return false;
			}
		});
		return (tooltip) ? tooltip : "";
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
};

Application.index = function() {
	this._init.apply(this, arguments);
}

Application.index.prototype = {
	
	_start : null,
	_end : null,
	
	_init : function(start, end) {
		this._start = start;
		this._end = end;
	},
	
	getIndex : function() {
		return {start : this._start, end : this._end};
	},
	
	getItemCount : function() {
		return (this._end - this._start + 1);
	},
	
	increment : function() {
		var itemCount = this.getItemCount();
		this._start = this._start + itemCount;
		this._end = this._end + itemCount;
		return {start : this._start, end : this._end};
	},
	
	getStartIndex : function() {
		return this._start;
	},
	
	getEndIndex : function() {
		return this._end;
	}
	
};

Application.timer = function() {
	this._init.apply(this, arguments);
};

Application.timer.prototype = {
	
	_delay : null,
	_retry : null,
	_maxRetry : null,
	
	_init : function() {
		this._delay = 1000;
		this._retry = 0;
		this._maxRetry = 100;
	},
	
	call : function(func) {
		if (this._retry < this._maxRetry) {
			setTimeout(func, this._delay);
		}
		this._retry++;
	},
	
	setMaxRetryCount : function(no) {
		this._maxRetry = no;
	}
};

Application.MotifConflication = function() {
	this._init.apply(this, arguments);
};

$(document).ready(function() {
	new Application.genocon();
});

body {
    font-family: sans-serif;
    font-size: 14px;
}

a {
    color: #3B5998;
    font-weight: bold;
    text-decoration: none;
}

#gcAppContainer {
	width: 900px;
}

.hidden {
	display:none;
}

.left {
    float: left;
}

.label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    min-width: 165px;
}

input.baseSequence {
	/*width: 100%;*/
}

.highlight-sequence {
	font-weight: bold;
}

.resultArea {
    font-family: "Courier New","Lucida Console";
    margin: 10px 0;
    min-width: 410px;
    overflow: auto;
    width: 100%;
	background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
	white-space: nowrap;
}

.resultArea .userSequence {
	white-space: nowrap;
	float: left;
}

.finishSequence,
.replaceSequenc {
   background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    margin: 10px 0 0;
	font-family: "Courier New","Lucida Console";
	width: 100%;
	overflow: auto;
	white-space: nowrap;
}

.wrappedSequenceMotif {
	background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    margin: 10px 0 0;
	font-family: "Courier New","Lucida Console";
	overflow: auto;
	word-wrap: break-word;
	white-space: normal;
	width:100%;
	height:90px;
	word-break: break-all;
}

.replace {
    color: #E80010;
}

.baseErrorMessage,
.errorMessage {
	color: black;
	/*text-align: center;*/
	margin-bottom: -10px;
    margin-top: 10px;
}

.errorText {
	color: #FF0000;
}

.applicationContainer {
    background-color: #F6F6F6;
    border: 1px solid #CCCCCC;
    margin: 5px 0 0;
    padding: 5px;
}

.actionButtonContainer {
    text-align: right;
}

.actionBtn {
    border: 1px solid #DDDDDD;
    cursor: pointer;
    display: inline-block;
    font-weight: bold;
    padding: 5px 2px;
    text-align: center;
    width: 25px;
}

.row {
    padding: 5px 0;
}
.row:after {
    clear: left;
    content: "";
    display: block;
}
.row input[type="text"] {
    width: 200px;
}

.row .externalLink {
	margin: 0 5px;
}

.noborder {
    border: medium none;
}

#baseSequenceContainer .baseSequenceBox {
	width: 100%;
	overflow: auto;
	white-space: nowrap;
}
#baseSequenceContainer .baseSequenceBox span,
#baseSequenceContainer .baseSequenceBox .baseSequence {
	font-family: Courier;
}

#baseSequenceContainer .baseSequenceBox .fixedSequence {
	position: relative;
	left: -6px;
	color: #AAAAAA;
	font-weight: bold;
}

.applicationContainer .nextButtonContainer {
	margin-top: 10px;
}

.databaseInfo .motif {
	width: 70%;
}

/**
 * button css
 */

a.useButton {
	width: 150px;
}

.actionBtn {
	border: 1px solid #DDDDDD;
    cursor: pointer;
    display: inline-block;
    font-weight: bold;
    padding: 5px 2px;
    text-align: center;
    width: 25px;
}

.actionBtn:hover {
	border: 1px solid #000000;
}

.btn {
  display: inline-block;
  *display: inline;
  /* IE7 inline-block hack */

*zoom: 1;
  padding: 4px 10px 4px;
  margin-bottom: 0;
  font-size: 13px;
  line-height: 18px;
  color: #333333;
  text-align: center;
  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);
  vertical-align: middle;
  background-color: #f5f5f5;
  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));
  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: linear-gradient(top, #ffffff, #e6e6e6);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);
  border-color: #e6e6e6 #e6e6e6 #bfbfbf;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
  border: 1px solid #cccccc;
  border-bottom-color: #b3b3b3;
  -webkit-border-radius: 4px;
  -moz-border-radius: 4px;
  border-radius: 4px;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  cursor: pointer;
  *margin-left: .3em;
}

.btn:hover,
.btn:active,
.btn.active,
.btn.disabled,
.btn[disabled] {
  background-color: #e6e6e6;
}

.btn:hover {
  color: #333333;
  text-decoration: none;
  background-color: #e6e6e6;
  background-position: 0 -15px;
  -webkit-transition: background-position 0.1s linear;
  -moz-transition: background-position 0.1s linear;
  -ms-transition: background-position 0.1s linear;
  -o-transition: background-position 0.1s linear;
  transition: background-position 0.1s linear;
}

.btn-blue,
.btn-blue:hover,
.btn-yellow,
.btn-yellow:hover,
.btn-red,
.btn-red:hover,
.btn-green,
.btn-green:hover,
.btn-lightblue,
.btn-lightblue:hover,
.btn-black,
.btn-black:hover {
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
  color: #ffffff;
}

.btn-blue {
  background-color: #0074cc;
  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);
  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));
  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);
  background-image: -o-linear-gradient(top, #0088cc, #0055cc);
  background-image: linear-gradient(top, #0088cc, #0055cc);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);
  border-color: #0055cc #0055cc #003580;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}

.btn-blue:hover,
.btn-blue:active,
.btn-blue.active,
.btn-blue.disabled,
.btn-blue[disabled] {
  background-color: #0055cc;
}

.btn-green {
  background-color: #5bb75b;
  background-image: -moz-linear-gradient(top, #62c462, #51a351);
  background-image: -ms-linear-gradient(top, #62c462, #51a351);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));
  background-image: -webkit-linear-gradient(top, #62c462, #51a351);
  background-image: -o-linear-gradient(top, #62c462, #51a351);
  background-image: linear-gradient(top, #62c462, #51a351);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);
  border-color: #51a351 #51a351 #387038;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-green:hover,
.btn-green:active,
.btn-green.active,
.btn-green.disabled,
.btn-green[disabled] {
  background-color: #51a351;
}
.btn-green:active,
.btn-green.active {
  background-color: #408140 ¥9;
}
.btn-lightblue {
  background-color: #49afcd;
  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));
  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: linear-gradient(top, #5bc0de, #2f96b4);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);
  border-color: #2f96b4 #2f96b4 #1f6377;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-lightblue:hover,
.btn-lightblue:active,
.btn-lightblue.active,
.btn-lightblue.disabled,
.btn-lightblue[disabled] {
  background-color: #2f96b4;
}

/* Dialog css */

.motifViewDialog .explanation {
	color: #AAAAAA;
	font-size: 12px;
	margin-left: 200px;
	margin-top : -10px;
}

.motifViewDialog .moreInfo {
	color: #3B5998;
	cursor: pointer;
}

.motifViewDialog .position {
	width: 70px;
}

.motifViewDialog .dialogErrorMessage {
	font-size: 12px;
}

.ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl {
    border-top-left-radius: 1px;
}
.ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr {
    border-top-right-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl {
    border-bottom-left-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br {
    border-bottom-right-radius: 1px;
}

.loadingImageContainer .loadingMessage {
	color: #FF0000;
}

.motifConflictionDialog .option {
	margin: 10px;
}

.motifViewDialog {
	margin-top: 10px;	
}

.motifViewDialog .label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    width : 200px;
}

.motifViewDialog .motifviewinfo {
	float: right;
    margin-top: -150px;
    position: relative;
    width: 350px;	
}

.deletelink {
	cursor: pointer;	
}

.deletelink img {
	margin-bottom: -3px;	
}

.manualMotifView .manualMotifViewInfo {
	float: right;
    height: 90px;
    margin-right: 10px;
    margin-top: -65px;
    position: relative;
    width: 380px;
}

.baseSequenceBox textarea {
	resize: none;	
	width: 490px;
	height: 115px;
}

.fixedSequenceCheckBox {
	float: right;
    margin-right: 210px;
    margin-top: -115px;
}

.fixedSequenceMsg {
	float: right;
    margin-right: 20px;
    margin-top: -40px;
}

.fixedSequenceMotif {
	display: inline;
    float: right;
    font-family: "Courier New","Lucida Console";
    margin-top: -15px;
}

.resultAreaUserMessageClass {
	color: #0A5DA6;
    font: bold 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    font-size: 12px;
    font-weight: bold;
    margin-top: -6px;
	margin-bottom: 4px;
}

.finishSequence {
	 background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    font-family: "Courier New","Lucida Console";
    height: 100px;
    margin: 10px 0 0;
    overflow: auto;
    width: 480px;
    word-break: break-all;
    word-wrap: break-word;
	white-space: normal;
}

.finishSequenceFixed {
	/*display: inline;
    float: right;
    font-family: "Courier New","Lucida Console";
    margin-top: -15px;*/
	display: inline;
    float: left;
    font-family: "Courier New","Lucida Console";
    margin-left: 488px;
    margin-top: -30px;
    overflow: auto;
    width: 400px;
	word-wrap: break-word;
}

.manualsequence {
	float: right;
    height: 40px;
    overflow: auto;
    width: 300px;
	margin-bottom: 5px;
}

.motifviewsequence {
	float: right;
    height: 40px;
    margin-bottom: 5px;
    overflow: auto;
    width: 240px;
}

div.warningTop {
	background-color:#F6F6F6;
	font-weight:bold;
	color:#223194;
}

.error {
	color:#ED4A68;
}

.loadingChart .loadChartMessage {
	color:#FF0000;
}

.loadingChart {
	text-align: center;
}

.bottomChartTitle {
    color: #0A5DA6;
    font: bold 12px "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
}

.finishSequenceMsg {
	color: #0A5DA6;
    float: right;
    font: bold 13px "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    margin-top: -80px;
    width: 400px;
}

<div id="tests"> </div>
<div class="warningTop">Hover mouse over menu items for tooltip descriptions</div>
</br>
<div id="gcAppContainer">

<div id="baseSequenceContainer">
	<div class="label baseSequenceLabel">Base Sequence</div>
	<div class="baseSequenceBox">
		<span>
			<textarea type="text" cols=45 rows=5 class="baseSequence" value="" disabled=true maxlength=500> </textarea>
		</span>
		
		<span class="fixedSequence">GATCCCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG</span>
		
		<div>
			<div class="fixedSequenceCheckBox"><input type="checkbox" id="chkEmptySequnce" value="true" checked=true>Start with empty sequence</div>
			<div class="fixedSequenceMsg">Minimal Promoter (fixed)</div>
		</div>
	</div>
	<div style="margin-top:5px;"><a class="useButton btn btn-green">Start promoter design</a></div>
	<div class="baseErrorMessage hidden"></div>
</div>
<div class="baseSequenceError hidden error">
	Warning: Motif contains nonstandard characters for DNA design. All characters except A, T, C, G will be treated as unique special characters. Currently IUPAC codes are not supported.
</div>
<div class="applicationContainer hidden">
	<div class="actionButtonContainer">
		<span class="appSummery"></span>
		<span class="collapseButton actionBtn" title="collapse">_</span>
		<span class="expandButton actionBtn" title="expand">+</span>
		<span class="removeButton actionBtn" title="remove">x</span>
		<br clear="all"/>
	</div>
	<div class="applicationDataContainer">
		
		<div class="row">
			<div class="label left optionListLabel">Select Tool</div>
			<div class="left">
				<select class="optionList"></select>
				
			</div>
		</div>

<div class="row hidden analysisMethodContainer">
			<div class="label left analysisMethodLabel">Analysis Method</div>
			<div class="left">
				<select class="analysisMethod"></select>
			</div>
		</div>
		
		<div class="row hidden expressionDbContainer">
			<div class="label left expressionDbLabel">Expression DataBase</div>
			<div class="left">
				<select class="expressionDb"></select>
			</div>
		</div>
		
		<div class="row hidden dataColContainer">
			<div class="label left dataColLabel">Data Collection</div>
			<div class="left">
				<select class="dataCol"></select>
			</div>
		</div>
		
		<div class="actionResultContainer"></div>
		<div class="nextButtonContainer hidden">
			<a class="btn nextButton">Next</a>
			<a class="btn repeatAgain">Repeat settings</a>
			<a class="btn finishNow">Finish Now</a>
		</div>
		<div class="finishSequenceContainer hidden">
			<div class="finishSequence"></div>
			<div class="finishSequenceMsg">Fixed minimal promoter sequence from -1 to -50 before the transcription start site, from CaMV35S promoter.</div>
			<div class="finishSequenceFixed"></div>
		</div>
	</div>
</div>
</div>

Tooltip

To facilitate the usability of PromoterCAD, we provide the tooltip informartion. Then it is easy for users to undergo the promoter motif manipulation.

Hover the cursor to the items such as the button "Start promoter design", and the PromoterCAD returns the messsage
"Start your promoter design with the empty sequence in the region -51 to -550 from the transcriptional start site."

Then users can start their promoter design by clicking the button.

Basic Usage

To execute the synthetic promoter design using the PromoterCAD, please go through the following workflow basically.

At first, with the menu "Select tool", users can select one of the functions for performing a particular data operation. For example, the function "MotifMaxExpress" finds motifs associated with maximum gene expression in a specific condition. Select this function to find motifs associated with strong expression in flower tissues.
With the menu "Analysis Method", users can select a regulatory motif data set (ATTED/PPDB) registered in LinkData.
With the menu "Expression Database", users can select microarray expression database (AtGenExpress/DIURNAL) registered in LinkData. Data containing the developmental series from AtGeneExpress has been split into a series of data tables by tissue type, and those from DIURNAL has been split into a a series of data tables by circadian growth condition.
With the menu "Data Collection", users can select the data tables corresponding to the interesting developmental/circadian condition. (e.g. "Flowering")
The next menu "Select Property", users can select one of the expression conditions associated with the database. For the AtGenExpress data, this is represented by a shorthand description. For example, "Col-0_flower" refers to the Columbia strain 0, grown for 4 weeks until the flowering stage. The gene expression levels are for the entire flower.
The full description of each experiment can be referenced on the TAIR website. For example, flowering experiments are described here:
http://arabidopsis.org/servlets/TairObject?type=bio_sample_collection&id=1006710 873#437
Select a particular experiment and MotifExpress will find known sequence motifs associated with high expression in this condition. MotifMaxExpress will automatically display these motif sequences (in this case septamers) in line with the base promoter sequence at the same location as they occur in the promoter returned by MotifExpress.
By clicking the button "Add motif", all the selected motifs are incorporated into the promoter motif skelton. The result will be displayed in the text area with the motifs indicated by color.
Click the button "Next", to repeat the sequence design operation and continue the workflow. (Continues the steps 1-6.)
In the final step, click the button "Finish Now" to fill in the skeleton (the 'bones' of the promoter, containing just regulatory motifs and the minimal promoter region) with the remaining sequence. This will replace the blank '-' sequences, but will preserve any motifs added in the design process.

Tutorials

Here are tutorials to execute synthetic promoter designs using PromoterCAD. These have example walk throughs with snapshots for each step.

Beginning_Tutorials_1	This tutorial illustrates how to design a synthetic promoter for Leaf specific expression using the MotifExpress tool.
Beginning_Tutorials_2	This tutorial illustrates how to design a synthetic promoter for Circadian expression with MotifCircadian tool.
Beginning_Tutorials_3	This tutorial illustrates how to use InputMotif tool to add specific motifs to a gene design.
Advanced_Tutorials_1	This tutorial illustrates how to fork your own PromoterCAD workspace.
Advanced_Tutorials_2A	This tutorial illustrates how to add a new normalized data to PromoterCAD.
Advanced_Tutorials_2B	This tutorial illustrates how to add a new database PLACE motif data to PromoterCAD.
Advanced_Tutorials_3A	This tutorial illustrates how to add a new data mining plugin tool MotifRanking.
Advanced_Tutorials_3B	This tutorial illustrates how to add a new data mining plugin tool MotifNonCircadian.
Advanced_Tutorials_4	This tutorial illustrates how to modify and upload your own tooltips.
Help Page	Interpreting PromoterCAD Output
Help Page	How to tag input LinkData tables for PromoterCAD

License

PromoterCAD source code is licensed under the LGPL-3.0 license (the GNU Lesser General Public License, version 3.0) and the Creative Commons license CC-BY-SA. So users can fork the source code of PromoterCAD to easily create their own data mining plugins.

Fork this app as your new one download

Web Search

Contributor Send Message	Koro_Nishikata
Collaborators	GenoCon Robert_Cox
Forked from (Parent App)	GenoCon 's PromoterCAD: Data Driven Design of Plant Regulatory DNA
Run count	333
Website	http://promotercad.org
License
Fork count	0
Created date	Apr 28, 2013
Last update date	May 16, 2013