Play
JavaScript
CSS
HTML
ReadMe
Snapshots

MotifMaxCircadian2 = function(containerId, options) {
	new Application.motifMaxCircadian(containerId, options);
};

if (Application === "undefined" || !Application) {
	var Application = {};
}

Application.motifMaxCircadian = function() {
	this._init.apply(this, arguments);
};

Application.motifMaxCircadian.prototype = {
	
	_containerId : null,
	_baseSequence : null,
	_options : null,
	_motifProperty : null,
	_heptamer : null,
	_octamer : null,
	_appSequence : null,
	_filteredSubjectList : null,
	_motifViewDialogId : null,
	_geneInfoContainerId : null,
	
	_default : {
		appName : "MotifMaxCircadian2",
		selectRangeCaption : "Select Range",
		selectPropertyAreaClass : "selectPropertyArea",
		selectPropertyClass : "selectProperty",
		resultAreaClass : "resultArea",
		replaceButtonAreaClass : "replaceButtonArea",
		replaceButtonClass : "replaceButton",
		nextButtonAreaClass : "nextButtonArea",
		replaceSequenceClass : "replaceSequence",
		errorMessageAreaClass : "errorMessage",
		dialogErrorMessageClass : "dialogErrorMessage",
		dialogOutRangeValueMessage : "Please input a value between {0} and {1}",
		noSequenceForThisRange : "No sequence found for this range",
		invalidDatabase : "Invalid database. Please select valid database.",
		databaseInfoClass : "databaseInfo",
		geneLabelClass : "geneUrl",
		geneInfoLinkClass : "geneInfoLink",
		motifSequenceProperty : "motif sequence",
		motifPositionProperty : "motif position",
		sinePhaseProperty : "Sine Phase",
		sineAmplitudeProperty : "Sine Amplitude",
		typeProperty : "type",
		validType : "REG",
		motifViewDialogId : "motifViewDialog",
		motifViewDialogClass : "motifViewDialog",
		motifViewDialogTitle : "Motif View",
		minSequenceClass : "minSeq",
		maxSequenceClass : "maxSeq",
		websiteNameAtted : "ATTED",
		websiteNamePpdb : "PPDB",
		baseSequenceMinLength : 50,
		dialogImageUrl : "http://app.linkdata.org/asset/a06f4de4.png",
		callback : function() {},
		loadingImageContainer : "loadingImageContainer",
		loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif",
		loadingMessageClass : "loadingMessage",
		loadingMessage : "Loading linked data, it may take a few minutes..."
	},
	
	_tag : {
		topResult : "result_top"
	},
	
	_init : function(containerId, options) {
		this._containerId = containerId;
		this._options = $.extend({}, this._default, options);
		this._baseSequence = this._options.baseSequence;
		this.filteredSubjectList = [];
		var date = new Date();
		this._geneInfoContainerId = "gene_info_containerId_" + date.getTime();
		this._initMotifProperty(this._options);
		this._initAppSequence(this._options);
		this._initHeptamer();
		this._initOctamer();
		this._initView();
		this._initMotifViewDialog();
	},
	
	_initMotifProperty : function(opts) {
		var obj = {
			workId : opts.workId,
			fileName : opts.fileName
		};
		this._motifProperty = new Application.motifProperty(obj);
	},
	
	_initAppSequence : function(opts) {
		var self = this;
		var timer = new Application.timer();
		var init = function() {
			var seqProperty = self._motifProperty.getPropertyByLabel(self._options.motifSequenceProperty);
			var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty);
			if (seqProperty && posProperty) {
				var obj = {
					workId : opts.workId,
					fileName : opts.fileName,
					baseSequence : self._baseSequence,
					motifSequenceProperty : seqProperty,
					motifPositionProperty : posProperty,
					containerId : self._containerId,
					errorMessageClass : self._options.errorMessageAreaClass,
					baseSequenceMinLength : self._options.baseSequenceMinLength
				};
				self._appSequence = new Application.sequence(obj);
			} else {
				timer.call(init);
			}
		}
		init();
	},
	
	_initHeptamer : function() {
		this._heptamer = new Application.heptamer();
	},
	
	_initOctamer : function() {
		this._octamer = new Application.octamer();
	},
	
	_initView : function() {
		this._initMainView();
		this._initDialogView();
	},
	
	_initMainView : function() {
		var self = this;
		var timer = new Application.timer();
		var fillOptionMethod = function() {
			var optionArray = self._motifProperty.getOptionArray();
			if (optionArray) {
				var sb = [];
				sb[sb.length] = "<div class='" + self._options.selectPropertyAreaClass + " row'>";
				sb[sb.length] = "<div class='label left'>" + self._options.selectRangeCaption + "</div>";
				sb[sb.length] = "<div class='left'>";
				sb[sb.length] = "<select class='" + self._options.selectPropertyClass + "'>";
				sb[sb.length] = "<option value='-1'>-- Select Range --</option>";
				sb[sb.length] = "<option value='0-4'>0 to 4</option>";
				sb[sb.length] = "<option value='4-8'>4 to 8</option>";
				sb[sb.length] = "<option value='8-12'>8 to 12</option>";
				sb[sb.length] = "<option value='12-16'>12 to 16</option>";
				sb[sb.length] = "<option value='16-20'>16 to 20</option>";
				sb[sb.length] = "<option value='20-24'>20 to 24</option>";
				sb[sb.length] = "</select>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>";
				sb[sb.length] = "<div id='" + self._geneInfoContainerId + "'></div>";
				sb[sb.length] = "<div class='" + self._options.resultAreaClass + " hidden'></div>";
				sb[sb.length] = "<div class='" + self._options.errorMessageAreaClass + " hidden'>error</div>";
				sb[sb.length] = "<div class='" + self._options.replaceButtonAreaClass + " hidden'>";
				sb[sb.length] = "<a class='" + self._options.replaceButtonClass + " btn btn-lightblue'>Replace</a>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "<div class='" + self._options.replaceSequenceClass + " hidden'></div>";
				sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>";
				sb[sb.length] = "<div class='" + self._options.loadingMessageClass + "'>" + self._options.loadingMessage + "</div>";
				sb[sb.length] = "<div>";
				sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "</div>";
				$("#" + self._containerId).html(sb.join(""));
				self._initSelectPropertyListener();
			} else {
				timer.call(fillOptionMethod);
			}
		}
		fillOptionMethod();
	},
	
	_initDialogView : function() {
		var sb = [], self = this, date = new Date();
		this._motifViewDialogId = "motifViewDialog_id_" + self._containerId + "_" + date.getTime();
		sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden'>";
		sb[sb.length] = "<input type='hidden' class='sequence'>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span>Place motif at position</span>";
		sb[sb.length] = "<input type='text' class='position'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span class='explanation'>Replace with prefer position between ";
		sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>";
		sb[sb.length] = "</span>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span>Number of extra copies</span>";
		sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span>Space between copies (Base Pairs)</span>";
		sb[sb.length] = "<input type='text' class='basePairs' value='0'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='motifImageArea'>";
		sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span class='explanation'>Click ";
		sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website";
		sb[sb.length] = "</span>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "</div>";
		$("#" + this._containerId).append(sb.join(""));
	},
	
	_initSelectPropertyListener : function() {
		var self = this, workId = self._options.workId, fileName = self._options.fileName;
		var timer = new Application.timer();
		var setSelectListener = function() {
			if ($("#" + self._containerId + " ." + self._options.selectPropertyClass).length != 0) {
				$("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() {
					$("#" + self._containerId + " ." + self._options.loadingImageContainer).show();
					self._appSequence.hideError();
					$("#" + self._containerId + " ." + self._options.resultAreaClass).hide();
					$("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide();
					$("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide();
					$("#" + self._containerId + " ." + self._options.databaseInfoClass).hide();
					$("#" + self._containerId + " #" + self._geneInfoContainerId).hide();
					var range = $("option:selected", this).val();
					if (range && range != -1) {
						self._showMotifMaxCircadian(workId, fileName, range);
					}
				});
			} else {
				timer.call(setSelectListener);
			}
		}
		setSelectListener();
	},
	
	_showGenePlot : function(subject) {
		var self = this;
		$("#" + self._containerId + " #" + self._geneInfoContainerId).show();
		var options = {
			workId : self._options.workId,
			fileName : self._options.fileName,
			subject : subject,
			property : ""
		};
		new Application.geneChart(self._geneInfoContainerId, options);
	},
	
	_showDataBaseInformationList : function() {
		var self = this, seqVal = [];
		$("#" + self._containerId + " .userSequence .hdnSequence").each(function() {
			var tmpPos = $(this).siblings(".hdnPosition").val();
			seqVal.push($(this).val() + "[" + tmpPos + "]");
		});
		self._showDatabaseInfo(seqVal.join(", "));
	},
	
	_initReplaceButtonLitener : function() {
		var self = this, workId = self._options.workId, fileName = self._options.fileName;
		$("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() {
			self._appSequence.hideError();
			$("#" + self._containerId + " ." + self._options.replaceSequenceClass).show();
			var seqs = [];
			$("#" + self._containerId + " .userSequence").each(function() {
				seqs.push($(this).text());
			});
			var html = self._appSequence.replace(seqs);
			$("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html);
			self._showDataBaseInformationList();
			self._options.callback();
		});
	},
	
	_initMotifSequenceListener : function() {
		var self = this;
		$("#" + self._containerId + " .motifSequence").click(function() {
			$("." + self._options.motifViewDialogClass).hide();
			var parent = $(this).closest('.userSequence');
			var container = $(this).closest('.userSequence');
			var seq = $(parent).find(".hdnSequence").val();
			var pos = $(parent).find(".hdnPosition").val();
			var seqEl = self._getSeqElBySeq(seq);
			var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos;
			self._initSequencePopup(seqEl);
			$("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide();
			$("#" + self._motifViewDialogId + " .sequence").val(seq);
			$("#" + self._motifViewDialogId + " .position").val(appropriatePos);
			$("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq));
			$("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq));
			self._initPositionInsert(seq, appropriatePos);
			$("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq});
			$("#" + self._motifViewDialogId).dialog("open");
			$("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show();
		});
	},
	
	_initSequencePopup : function(seqEl) {
		var self = this;
		$("#" + self._motifViewDialogId + " .moreInfo").unbind("click");
		var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#";
		$("#" + self._motifViewDialogId + " .moreInfo").click(function() {
			self._showPopupWindow(url);
		});
	},
	
	_showPopupWindow : function(url) {
		var winWidth = 800;
		var winHeight = 800;
		var winLeft = parseInt((screen.availWidth/2) - (winWidth/2));
		var winTop = parseInt((screen.availHeight/2) - (winHeight/2));
		var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1";
		window.open(url, "Motif", winStyle);
	},
	
	_initPositionInsert : function(seq, pos) {
		var self = this;
		var mod = seq.length % 2;
		$("#" + self._motifViewDialogId + " .position").unbind("keyup");
		$("#" + self._motifViewDialogId + " .position").keyup(function() {
			var val = $(this).val();
			if (isNaN(val)) {
				$(this).val(pos);
				return;
			}
			var tmpVal = new String(val);
			if (mod == 0) {
				if (tmpVal.indexOf(".") == -1) {
					$(this).val(tmpVal + ".5");
				} else {
					$(this).val(tmpVal.split(".")[0] + ".5");
				}
			} else {
				if (tmpVal.indexOf(".") > -1) {
					$(this).val(tmpVal.split(".")[0]);
				}
			}
		});
	},
	
	_initMotifViewDialog : function() {
		var self = this;
		$("#" + self._motifViewDialogId).dialog({
			autoOpen: false,
			title: self._default.motifViewDialogTitle,
			width: 520,
			dialogClass : self._options.motifViewDialogClass,
			buttons : [
				{
					text: "Replace",
					click : function() {
						var seq = $("#" + self._motifViewDialogId).find(".sequence").val();
						var pos = $("#" + self._motifViewDialogId).find(".position").val();
						var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val());
						var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val());
						var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html());
						var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html());
						if (minPos > pos || maxPos < pos) {
							$dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass);
							$dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos));
							$dialogError.show();
							return;
						}
						self._replaceWithSequence(seq, pos, extraCopies, basePairs);
						$(this).dialog("close");
					}
				},
				{
					text: "Cancel",
					click : function() {
						$(this).dialog("close");
					}
				}
			]
		});
	},
	
	_getMotifMaxCircadianTriple : function(workId, fileName, range) {
		var self = this;
		var property = self._motifProperty.getPropertyByLabel(self._options.sinePhaseProperty);
		var amplitudeProperty = self._motifProperty.getPropertyByLabel(self._options.sineAmplitudeProperty);
		if (!property) {
			$("#" + self._containerId + " ." + self._options.loadingImageContainer).hide();
			self._appSequence._showError(self._options.invalidDatabase);
			return;
		}
		var index = new Application.index(1, 5000);
		var maxCircadianTriple;
		var getSinePhasePropertyList = function(sinePhaseTripleList) {
			var getSineAmplitudePropertyList = function(amplitudeTripleList) {
				var tmpMaxCircadianTriple = self._getMaxCircadianTriple(range, sinePhaseTripleList, amplitudeTripleList);
				if (tmpMaxCircadianTriple) {
					if (!maxCircadianTriple) {
						maxCircadianTriple = tmpMaxCircadianTriple;
					}
					var tmpMaxValue = parseFloat(maxCircadianTriple.object);
					var currentValue = parseFloat(tmpMaxCircadianTriple.object);
					if (Math.max(tmpMaxValue, currentValue) != tmpMaxValue) {
						maxCircadianTriple = tmpMaxCircadianTriple;
					}
				}
				if (sinePhaseTripleList && sinePhaseTripleList.length == index.getItemCount()) {
					LinkData.getTriplesByProperty(workId, fileName, property, getSinePhasePropertyList, index.increment());
				} else {
					self._motifMaxCircadianSequence(workId, fileName, maxCircadianTriple.subject);
				}
			}
			LinkData.getTriplesByProperty(workId, fileName, amplitudeProperty, getSineAmplitudePropertyList, index.getIndex());
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getSinePhasePropertyList, index.getIndex());
	},
	
	_showMotifMaxCircadian : function(workId, fileName, range) {
		var self = this;
		var arr = range.split("-");
		var rangePhrase = "_" + arr[0] + "to" + arr[1]; 
		var fileSuffix =  rangePhrase + "_top";
		var foundTopFile = false;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(wId, fileList) {
				$.each(fileList, function(fKey, fName) {
					var tmpName = fName.split(fileSuffix);
					if (fileName.indexOf(tmpName[0]) > -1) {
						var propLabel = fileName.split(tmpName[0] + "_")[1] + rangePhrase;
						self._getTopFilePropertyList(workId, fileName, wId, fName, propLabel);
						foundTopFile = true;
						return false;
					}
				});
				if (foundTopFile) {
					return false;
				}
			});
			if (!foundTopFile) {
				self._getMotifMaxCircadianTriple(workId, fileName, range);
			}
		}
		LinkData.getFilesByTag(null, self._tag.topResult, getFilesByTag);
	},
	
	_getTopFilePropertyList : function(workId, fileName, topWorkId, topFileName, propLabel) {
		var self = this;
		var getProperties = function(propList) {
			$.each(propList, function(propKey, propValue) {
				var tmpProp = self._motifProperty._getLabel(propValue);
				if (tmpProp.indexOf(propLabel) > -1) {
					self._showMaxCircadian(workId, fileName, topWorkId, topFileName, propValue);
					return false;
				}
			});
		}
		LinkData.getProperties(topWorkId, topFileName, getProperties);
	},
	
	_showMaxCircadian : function(workId, fileName, topWorkId, topFileName, topProperty) {
		var self = this;
		var index = new Application.index(1, 1000);
		var getTriplesByProperty = function(tripleList) {
			self._showMotifMaxCircadianByTripleList(workId, fileName, tripleList);
		}
		LinkData.getTriplesByProperty(topWorkId, topFileName, topProperty, getTriplesByProperty, index.getIndex());
	},
	
	_showMotifMaxCircadianByTripleList : function(workId, fileName, tripleList) {
		var self = this, i = 0, subject = tripleList[i].object;
		var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty);
		var showMaxCircadianMotif = function(posTripleList) {
			var found = false;
			i++;
			$.each(posTripleList, function(pKey, pValue) {
				var tmpPos = parseInt(pValue);
				if (self._options.baseSequenceMinLength < tmpPos && self._options.baseSequence.length >= tmpPos) {
					found = true;
					self._motifMaxCircadianSequence(workId, fileName, subject);
					return false;
				}
			});
			if (! found) {
				subject = tripleList[i].object;
				LinkData.getObjects(workId, fileName, subject, posProperty, showMaxCircadianMotif);
			}
		}
		LinkData.getObjects(workId, fileName, subject, posProperty, showMaxCircadianMotif);
	},
	
	_getMaxCircadianTriple : function(range, sinePhaseTripleList, amplitudeTripleList) {
		var self = this, arr = range.split("-");
		var startValue = parseFloat(arr[0]), endValue = parseFloat(arr[1]);
		var maxIndex = -1, maxValue = -99999;
		$.each (sinePhaseTripleList, function(tKey, tValue) {
			var tmpVal = parseFloat(tValue.object);
			if (tmpVal != endValue && Math.max(tmpVal, startValue) == tmpVal && Math.min(tmpVal, endValue) == tmpVal) {
				$.each (amplitudeTripleList, function(aKey, aValue) {
					if (tValue.subject == aValue.subject) {
						var amplitude = parseFloat(aValue.object);
						if (Math.max(maxValue, amplitude) != maxValue) {
							maxValue = amplitude;
							maxIndex = aKey;
						}	
					}
				});
			}
		});
		if (maxIndex != -1) {
			return amplitudeTripleList[maxIndex];
		}
	},
	
	_getDataBaseWebsiteName : function() {
		var self = this;
		var fileName = self._options.fileName
		if (fileName.indexOf(self._options.websiteNameAtted) > -1) {
			return self._options.websiteNameAtted;
		} else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) {
			return self._options.websiteNamePpdb;
		} else {
			return "UNKNOWN";
		}
	},
	
	_motifMaxCircadianSequence : function(workId, fileName, subject) {
		var self = this;
		var drawSequence = function(seqHtml) {
			var sb = [];
			sb[sb.length] = "<input type='hidden' class='" + self._default.geneLabelClass + "' value='" + subject + "'/>";
			sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>";
			sb[sb.length] = seqHtml;
			$("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join(""));
			if (seqHtml.length == 0) {
				$("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide();
			}
			self._initMotifSequenceListener();
			self._initReplaceButtonLitener();
			self._showDataBaseInformationList();
			self._showGenePlot(subject);
			$("#" + self._containerId + " ." + self._options.resultAreaClass).show();
			$("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show();
			$("#" + self._containerId + " ." + self._options.loadingImageContainer).hide();
		}
		self._appSequence.getSequenceHtml(subject, drawSequence);
	},
	
	_getMinPosition : function(seq) {
		var self = this;
		var mod = seq.length % 2;
		var tHold = (mod == 1) ? 1 : 0.5;
		return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold;
	},
	
	_getMaxPosition : function(seq) {
		var self = this;
		var mod = seq.length % 2;
		var tHold = (mod == 1) ? 0 : 0.5;
		return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold;
	},
	
	_getSeqElBySeq : function(seq) {
		if (seq && seq.trim().length == 7) {
			return this._heptamer.getBySequence(seq);
		} else if (seq && seq.trim().length == 8) {
			return this._octamer.getBySequence(seq);
		}
	},
	
	_showDatabaseInfo : function(seqVal) {
		var self = this, fileName = self._options.fileName, appName = self._options.appName;
		var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val();
		var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val();
		var label = self._motifProperty._getDisplayLabel(propLabel);
		label = (label && label.trim().length != 0) ? label : propLabel;
		var usedMotif = (seqVal.length != 0) ? seqVal : "-";
		var dbInfoHtml = self._getDatabaseInfo(fileName, appName, subject, label, usedMotif);
		$("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml);
		$("#" + self._containerId + " ." + self._options.databaseInfoClass).show();
		self._genePreviewListener(subject);
	},
	
	_genePreviewListener : function(subject) {
		var self = this;
		$("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() {
			self._showPopupWindow(subject);
		});
	},
	
	_getDatabaseInfo : function(fileName, method, subject, property, motif) {
		var self = this;
		var gene = self._motifProperty.getGeneBySubject(subject);
		var sb = [];
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Database</div>";
		sb[sb.length] = "<div class='left'>" + fileName + "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Application</div>";
		sb[sb.length] = "<div class='left'>" + method + "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Gene Locus</div>";
		sb[sb.length] = "<div class='left'><a href='javascript:void(0);' class='" + self._options.geneInfoLinkClass + "'>" + gene + "</a></div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Range</div>";
		sb[sb.length] = "<div class='left'>" + property + "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Motif</div>";
		sb[sb.length] = "<div class='left motif'>" + motif + "</div>";
		sb[sb.length] = "</div>";
		return sb.join("");
	},
	
	_replaceWithSequence : function(seq, pos, extraCopies, basePairs) {
		var self = this;
		var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs);
		$("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html);
		$("#" + self._containerId + " ." + self._options.replaceSequenceClass).show();
		var seqLabel = seq + "[" + pos + "]";
		self._showDatabaseInfo(seqLabel);
		self._options.callback();
	}
	
};

Application.geneChart = function() {
	this._init.apply(this, arguments);
};

Application.geneChart.prototype = {
	
	_containerId : null,
	_options : null,
	_workId : null,
	_fileName : null,
	_subject : null,
	_property : null,
	_highChartContainerId : null,
	_appProperty : null,
	
	_default : {
		filterNamespace : "http://linkdata.org/",
		acceptPropLabelPrefix : "label:"
	},
	
	_init : function(containerId, options) {
		this._containerId = containerId;
		this._options = $.extend({}, this._default, options);
		this._workId = this._options.workId;
		this._fileName = this._options.fileName;
		this._subject = this._options.subject;
		this._property = this._options.property;
		var date = new Date();
		this._highChartContainerId = "gene_chart_" + date.getTime();
		this._initAppProperty(this._options);
		this._initView();
		this._drawHighChart(this._subject, this._property);
	},
	
	_initAppProperty : function(opts) {
		var obj = {
			workId : opts.workId,
			fileName : opts.fileName
		};
		this._appProperty = new Application.motifProperty(obj);
	},
	
	_initView : function() {
		var self = this;
		var sb = [];
		sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>";
		$("#" + self._containerId).html(sb.join(""));
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_drawHighChart : function(subject, highlightProperty) {
		var self = this;
		var getDataArray = function(tripleList) {
			var dataArray = [];
			var dataObject = {};
			var array = [];
			var duplicateProperty = [];
			$.each (tripleList, function(tKey, tValue) {
				var property = tValue.property;
				if (property.indexOf(self._options.filterNamespace) == -1) {
					return;
				}
				if ($.inArray(property, duplicateProperty) > -1) {
					return;
				}
				var label = self._getLabelAfterHash(property);
				if (!self._ignore(label)) {
					var val = parseFloat(tValue.object);
					if (highlightProperty === property) {
						val = self._getHighLightColumn(parseFloat(tValue.object));
					}
					array.push(val);
					duplicateProperty.push(property);
				}
			});
			dataObject.name = self._getLabel(subject);
			dataObject.data = array;
			dataArray.push(dataObject);
			self._getXCategory(tripleList, dataArray, highlightProperty);
		}
		LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray);
	},
	
	_getXCategory : function(tripleList, dataArray, highlightProperty) {
		var self = this;
		var array = [];
		var duplicateProperty = [];
		var hLabel = self._getLabelAfterHash(highlightProperty);
		$.each (tripleList, function(tKey, tValue) {
			var property = tValue.property;
			if (property.indexOf(self._options.filterNamespace) == -1) {
				return;
			}
			if ($.inArray(property, duplicateProperty) > -1) {
				return;
			}
			var label = self._getLabelAfterHash(property);
			if (!self._ignore(label)) {
				var displayLabel = self._getDisplayLabel(label);
				var hDisplayLabel = self._getDisplayLabel(hLabel);
				if (displayLabel === hDisplayLabel) {
					displayLabel = "<span style=\"color:#FB3B44\">" + hDisplayLabel + "</span>";
				}
				array.push(displayLabel);
				duplicateProperty.push(property);
			}
		});
		self._drawChart(self._highChartContainerId, dataArray, array);
	},
	
	_getHighLightColumn : function(val) {
		var obj = {};
		obj.y = val;
		obj.marker = {
			lineWidth: 3,
			lineColor: "#FB3B44",
			fillColor: "#FB3B44"
		};
		return obj;
	},
	
	_drawChart : function(containerId, dataArray, xCategory) {
		var self = this;
		var chart = new Highcharts.Chart({
			chart: {
				renderTo: containerId,
				type: 'line',
				marginRight: 130,
				marginBottom: 125
			},
			title: {
				text: self._fileName
			},
			xAxis: {
				categories: xCategory,
				labels : {
					rotation: 315
				}
			},
			tooltip: {
				formatter: function() {
					return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']';
				}
			},
			legend: {
				layout: 'vertical',
				align: 'right',
				verticalAlign: 'top',
				x: -10,
				y: 100,
				borderWidth: 0
			},
			series: dataArray
 		});
	},
	
	_getLabel : function(value) {
		var self = this, label;
		if (value.indexOf("#") > -1) {
			label = self._getLabelAfterHash(value);
		} else {
			label = self._appProperty.getGeneBySubject(value);
		}
		if (!label) {
			label = value;
		}
		return label;
	},
	
	_getPropertyLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
			propLabel = this._appProperty.getPropertyNameByLabel(propLabel);
		}
		return propLabel;
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
	
};

Application.motifProperty = function() {
	this._init.apply(this, arguments);
};

Application.motifProperty.prototype = {

_options : null,
	_propMap : null,
	_nameMap : null,
	_optionArray : null,
	
	_default : {
		acceptPropLabelPrefix : "label:",
		subjectATTEDUriPhrase : "http://atted.jp/data/locus/",
		subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene="
	},
	
	_init : function(options) {
		this._options = $.extend({}, this._default, options);
		this._propMap = [];
		this._nameMap = [];
		this._initPropMap(this._options);
	},
	
	_initPropMap : function(opts) {
		var self = this, workId = opts.workId, fileName = opts.fileName;
		var method = function(properties) {
			self._fillPropMap(self, properties);
			self._initOptionArray(properties);
		}
		LinkData.getProperties(workId, fileName, method);
	},
	
	_fillPropMap : function(self, properties) {
		$.each(properties, function(key, value) {
			var label = self._getLabel(value);
			if (!self._propMap[label]) {
				self._propMap[label] = value;
			}
		});
	},
	
	_initOptionArray : function(propertyList) {
		var self = this, list = new Object();
		var workId = self._options.workId, fileName = self._options.fileName;
		self._optionArray = [];
		$.each(propertyList, function(key, value) {
			var propLabel = self._getLabel(value);
			if (!self._ignore(propLabel)) {
				var obj = {};
				obj.key = propLabel;
				obj.value = self._getDisplayLabel(propLabel);
				self._optionArray.push(obj);
			}
		});
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_getLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},

getOptionArray : function() {
		return this._optionArray;
	},
	
	getPropertyByLabel : function(label) {
		return this._propMap[label];
	},
	
	getGeneBySubject : function(subject) {
		var self = this, htmlExt = ".html", geneLabel;
		if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, "");
		} else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, "");
		}
		if (geneLabel && geneLabel.indexOf(htmlExt) > -1) {
			geneLabel = geneLabel.replace(htmlExt, "");
		}
		return geneLabel;
	}
	
};

Application.sequence = function() {
	this._init.apply(this, arguments);
};

Application.sequence.prototype = {
	
	CHAR_SEQ_EMPTY : "-",
	
	_options : null,
	_workId : null,
	_fileName : null,
	_seqProperty : null,
	_posProperty : null,
	_baseSequence : null,
	_sequenceList : null,
	_positionList : null,
	_containerId : null,
	_errorContainerClass : null,
	_outOfRangeArray : null,
	
	_default : {
		msgInvalidSequence: "invalid sequence.",
		msgOutOfRangeSequence: "out of range sequence : {0}",
	},
	
	_init : function(options) {
		this._options = options;
		this._workId = this._options.workId;
		this._fileName = this._options.fileName;
		this._seqProperty = this._options.motifSequenceProperty;
		this._posProperty = this._options.motifPositionProperty;
		this._baseSequence = this._options.baseSequence;
		this._containerId = this._options.containerId;
		this._errorContainerClass = this._options.errorMessageClass;
	},
	
	_getCustomSequenceHtml : function(baseSequence, sequence, position) {
		var seqLen = sequence.length;
		var tHold = Math.floor(seqLen / 2) + 1;
		var pos = parseInt(position);
		var baseSeqLen = baseSequence.length;
		var suffixLen = baseSeqLen - tHold - pos;
		var sb = [];
		if (pos > this._options.baseSequenceMinLength && suffixLen > 0) {
			for (var i = 0; i < suffixLen; i++) {
				sb.push(this.CHAR_SEQ_EMPTY);
			}
			sb.push("<a href='javascript:void(0)' class='motifSequence'>" + sequence + "</a>");
			sb.push("<input type='hidden' class='hdnSequence' value='" + sequence + "'/>");
			sb.push("<input type='hidden' class='hdnPosition' value='" + pos + "'/>");
		} else {
			//_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence));
			this._outOfRangeArray.push(sequence + "[" + pos + "]");
			this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.join(", ")));
		}
		return sb.join("");
	},
	
	_isValidSequenceList : function(seqs) {
		var count = seqs.length;
		var maxlength = 0;
		for (var i = 0; i < count; i++) {
			if (seqs[i].length > maxlength) {
				maxlength = seqs[i].length;
			}
		}
		var result = true;
		for (var i = 0; i < maxlength; i++) {
			var chars = [];
			for (var j = 0; j < count; j++) {
				chars.push(seqs[j].charAt(i));
			}
			if (! this._isValidChars(chars.join(""))) {
				result = false;
				break;
			}
		}
		return result;
	},
	
	_isValidChars : function(charString) {
		var charLen = charString.length;
		var result = true;
		var first = null;
		for (var i = 0; i < charLen; i++) {
			if (charString.charAt(i) == this.CHAR_SEQ_EMPTY) {
				continue;
			}
			if (! first) {
				first = charString.charAt(i);
			}
			var current = charString.charAt(i);
			if (current && first != current) {
				result = false;
				break;
			}
		}
		return result;
	},
	
	_getReplacedCustomSequence : function(seqs) {
		var mergeSequence = this._getmergeCharSequence(seqs);
		var maxlength = this._baseSequence.length;
		
		var sb = [];
		for (var i = 0; i < maxlength; i++) {
			var bChar = this._baseSequence.charAt(i);
			var mChar = mergeSequence.charAt(i);
			if (mChar !== this.CHAR_SEQ_EMPTY) {
				// replaced
				sb.push(mChar);
			} else {
				sb.push(bChar);
			}
		}
		
		return sb.join("");
	},
	
	_getmergeCharSequence : function(seqs) {
		var count = seqs.length;
		var maxlength = this._baseSequence.length;
		var sb = [];
		for (var i = 0; i < maxlength; i++) {
			var chars = [];
			for (var j = 0; j < count; j++) {
				chars.push(seqs[j].charAt(i) ? seqs[j].charAt(i) : this.CHAR_SEQ_EMPTY);
			}
			sb.push(this._getMergeChar(chars.join("")));
		}
		return sb.join("");
	},
	
	_getMergeChar : function(charString) {
		var charLen = charString.length;
		var result = null;
		for (var i = 0; i < charLen; i++) {
			if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) {
				result = charString.charAt(i);
				break;
			}
		}
		if (!result) {
			result = this.CHAR_SEQ_EMPTY;
		}
		return result;
	},
	
	_wrappedReplacedSequenceHtml : function(replaceSequence, seqs) {
		var mergeSequence = this._getmergeCharSequence(seqs);
		var length = this._baseSequence.length;
		var sb = [];
		for (var i = 0; i < length; i++) {
			var bChar = this._baseSequence.charAt(i);
			var rChar = replaceSequence.charAt(i);
			var mChar = mergeSequence.charAt(i);
			var seqChar = (bChar !== rChar) ? "<span class='replace'>" + rChar + "</span>" : rChar;
			if (mChar !== this.CHAR_SEQ_EMPTY) {
				sb.push("<span class='highlight-sequence'>" + seqChar + "</span>");
			} else {
				sb.push(seqChar);
			}
		}
		return sb.join("");
	},
	
	_showError : function(message) {
		$errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass);
		$errorMessageContainer.html(message);
		$errorMessageContainer.show();
	},
	
	getSequenceHtml : function(subject, drawSequence) {
		var self = this;
		self._outOfRangeArray = [];
		var sb = [], baseSequence = self._baseSequence;
		var getTriplesBySequenceProperty = function(sequenceList) {
			self._getTriplesBySequenceProperty(subject, drawSequence, sequenceList);
		}
		LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty, getTriplesBySequenceProperty);
	},
	
	_getTriplesBySequenceProperty : function(subject, drawSequence, sequenceList) {
		var self = this;
		var getTriplesByPositionProperty = function(positionList) {
			self._drawSequenceList(drawSequence, sequenceList, positionList);
		}
		LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty, getTriplesByPositionProperty);
	},
	
	_drawSequenceList : function(drawSequence, sequenceList, positionList) {
		var self = this, sb = [];
		if (!sequenceList || sequenceList.length == 0) {
			return;
		}
		for (var i = 0; i < sequenceList.length; i++) {
			var customSeqString = self._getCustomSequenceHtml(self._baseSequence, sequenceList[i], positionList[i]);
			if (customSeqString.length > 0) {
				sb.push("<div class='userSequence'>" + customSeqString + "</div>");
			}
		}
		drawSequence(sb.join("\n"));
	},
	
	replace : function(seqs) {
		var isValid = this._isValidSequenceList(seqs);
		if (isValid) {
			if (seqs.length > 0) {
				var replaceSeq = this._getReplacedCustomSequence(seqs);
				var replaceSeqHtml = this._wrappedReplacedSequenceHtml(replaceSeq, seqs);
				return replaceSeqHtml;
			}
		} else {
			this._showError(this._default.msgInvalidSequence);
		}
	},
	
	replaceWith : function(seq, pos, extraCopies, basePairs) {
		var main = [];
		var seqLen = seq.length;
		var tHold = Math.floor(seqLen / 2) + 1;
		var pos = parseInt(pos);
		var baseSeqLen = this._baseSequence.length;
		var len = baseSeqLen - tHold - pos;
		for (var j = 0; j < extraCopies + 1; j++) {
			var array = [];
			for (var i = 0; i < len; i++) {
				array.push(this.CHAR_SEQ_EMPTY);
			}
			array.push(seq);
			main.push(array.join(""));
			len = len - seqLen - basePairs;
			if (len < 0) {
				break;
			}
		}
		return this.replace(main);
	},
	
	hideError : function() {
		$errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide();
	}
	
};

Application.heptamer = function() {
	this._init.apply(this, arguments);
};

Application.heptamer.prototype = {
	
	_heptamerMap : null,
	_motifSequenceProperty : null,
	_appropriatePositionProperty : null,
	
	_default : {
		heptamerTag : "heptamer",
		filterSequencePropertyPhrase : "motif_sequence",
		filterMaxCEGPropertyPhrase : "maxCEG",
		filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)"
	},
	
	_init : function() {
		this._heptamerMap = [];
		this._initHeptamerList();
	},
	
	_initHeptamerList : function() {
		var self = this;
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initHeptamer(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._default.heptamerTag, getFilesByTag);
	},
	
	_initHeptamer : function(workId, fileName) {
		var self = this;
		var getPropertyList = function(propertyList) {
			self._initProperty(propertyList);
			self._getSequenceTriple(workId, fileName);
		}
		LinkData.getProperties(workId, fileName, getPropertyList);
	},
	
	_initProperty : function(propertyList) {
		var self = this;
		$.each(propertyList, function(propKey, propValue) {
			if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) {
				self._motifSequenceProperty = propValue;
			} else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) {
				self._appropriatePositionProperty = propValue;
			}
		});
	},
	
	_getSequenceTriple : function(workId, fileName) {
		var self = this;
		var getSequenceTripleList = function(sequenceTripleList) {
			self._fillHeptamerMap(workId, fileName, sequenceTripleList);
		}
		LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList);
	},
	
	_fillHeptamerMap : function(workId, fileName, sequenceTripleList) {
		var self = this;
		var getPositionTripleList = function(positionTripleList) {
			for (var i = 0; i < sequenceTripleList.length; i++) {
				var seqTriple = sequenceTripleList[i];
				var posTriple = positionTripleList[i];
				var seqEl = new Application.seqElement();
				seqEl.setExternalUrl(seqTriple.subject);
				seqEl.setSequence(seqTriple.object);
				seqEl.setAppropriatePos(posTriple.object);
				self._heptamerMap[seqTriple.object] = seqEl;
			}
		}
		LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList);
	},
	
	getBySequence : function(sequence) {
		return this._heptamerMap[sequence];
	}
	
};
	
Application.octamer = function() {
	this._init.apply(this, arguments);
}
	
Application.octamer.prototype = {
	
	_octamerMap : null,
	_motifSequenceProperty : null,
	_appropriatePositionProperty : null,
	
	_default : {
		octamerTag : "octamer",
		filterSequencePropertyPhrase : "sequence",
		filterAppropriatePosition : "Appropriate%20position"
	},
	
	_init : function() {
		this._octamerMap = [];
		this._initOctamerList();
	},
	
	_initOctamerList : function() {
		var self = this;
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initOctamer(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._default.octamerTag, getFilesByTag);
	},
	
	_initOctamer : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			self._initProperty(propertyList);
			self._getSequenceTriple(workId, fileName);
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_initProperty : function(propertyList) {
		var self = this;
		$.each(propertyList, function(propKey, propValue) {
			if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) {
				self._motifSequenceProperty = propValue;
			} else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) {
				self._appropriatePositionProperty = propValue;
			}
		});
	},
	
	_getSequenceTriple : function(workId, fileName) {
		var self = this;
		var getSequenceTripleList = function(sequenceTripleList) {
			self._fillOctamerMap(workId, fileName, sequenceTripleList);
		}
		LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList);
	},
	
	_fillOctamerMap : function(workId, fileName, sequenceTripleList) {
		var self = this;
		var getPositionTripleList = function(positionTripleList) {
			for (var i = 0; i < sequenceTripleList.length; i++) {
				var j = Math.floor(i / 2);
				var seqTriple = sequenceTripleList[i];
				var posTriple = positionTripleList[j];
				var seqEl = new Application.seqElement();
				seqEl.setExternalUrl(seqTriple.subject);
				seqEl.setSequence(seqTriple.object);
				seqEl.setAppropriatePos(posTriple.object);
				self._octamerMap[seqTriple.object] = seqEl;
			}
		}
		LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList);
	},
	
	getBySequence : function(sequence) {
		return this._octamerMap[sequence];
	}
	
};

Application.seqElement = function() {
	this._init.apply(this, arguments);
};

Application.seqElement.prototype = {
	
	_externalUrl : null,
	_sequence : null,
	_appropriatePos : null,
	
	_init : function() {},
	
	getExternalUrl : function() {
		return this._externalUrl;
	},

setExternalUrl : function(externalUrl) {
		this._externalUrl = externalUrl;
	},
	
	getSequence : function() {
		return this._sequence;
	},
	
	setSequence : function(sequence) {
		this._sequence = sequence;
	},
	
	getAppropriatePos : function() {
		return this._appropriatePos;
	},
	
	setAppropriatePos : function(appropriatePos) {
		this._appropriatePos = appropriatePos;
	}
	
};

Application.timer = function() {
	this._init.apply(this, arguments);
};

Application.timer.prototype = {
	
	_delay : null,
	_retry : null,
	_maxRetry : null,
	
	_init : function() {
		this._delay = 1000;
		this._retry = 0;
		this._maxRetry = 100;
	},
	
	call : function(func) {
		if (this._retry < this._maxRetry) {
			setTimeout(func, this._delay);
		}
		this._retry++;
	}
};

Application.index = function() {
	this._init.apply(this, arguments);
}

Application.index.prototype = {
	
	_start : null,
	_end : null,
	
	_init : function(start, end) {
		this._start = start;
		this._end = end;
	},
	
	getIndex : function() {
		return {start : this._start, end : this._end};
	},
	
	getItemCount : function() {
		return (this._end - this._start + 1);
	},
	
	increment : function() {
		var itemCount = this.getItemCount();
		this._start = this._start + itemCount;
		this._end = this._end + itemCount;
		return {start : this._start, end : this._end};
	},
	
	getStartIndex : function() {
		return this._start;
	},
	
	getEndIndex : function() {
		return this._end;
	}
	
};

$(document).ready(function() {
	var fillDatabase = function(resultList) {
		$(".motifMaxCircadianDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>");
		$.each(resultList, function(workId, fileList) {
			$.each(fileList, function(fileKey, fileName) {
				$(".motifMaxCircadianDatabase").append("<option value='" + workId + "|" + fileName + "'>" + fileName + "</option>");
			});
		});
		$(".motifMaxCircadianDatabase").change(function() {
			var dbKey = $("option:selected", $(this)).val();
			if (dbKey == -1) {
				$("#container").html("");
				return;
			}
			var array = dbKey.split("|");
			var containerId = "container";
			var options = {
				workId : array[0],
				fileName : array[1],
				baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC"
			};
			new Application.motifMaxCircadian(containerId, options);
		});
	}
	LinkData.getFilesByTag(null, "database", fillDatabase);
});

body {
    font-family: sans-serif;
    font-size: 14px;
}

a {
    color: #3B5998;
    font-weight: bold;
    text-decoration: none;
}

.hidden {
	display:none;
}

.left {
    float: left;
}

.label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    min-width: 125px;
}

.row {
    padding: 5px 0;
}

.row:after {
    content: "";
    clear: left;
    display: block;
}

.row input[type="text"] {
    width: 200px;
}

.highlight-sequence {
	font-weight: bold;
}

.resultArea {
    font-family: "Courier New","Lucida Console";
    margin: 10px 0;
    min-width: 410px;
    overflow: auto;
    width: 100%;
	background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
}
.replaceSequence {
    background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    margin: 10px 0 0;
	font-family: "Courier New","Lucida Console";
	width: 100%;
	overflow: auto;
}

.replace {
    color: #E80010;
}

.errorMessage {
	color: #FF0000;
	text-align: center;
}

.databaseInfo .motif {
	width: 70%;
}

/**
 * button css
 */
.actionBtn {
	border: 1px solid #DDDDDD;
    cursor: pointer;
    display: inline-block;
    font-weight: bold;
    padding: 5px 2px;
    text-align: center;
    width: 25px;
}

.actionBtn:hover {
	border: 1px solid #000000;
}

.btn {
  display: inline-block;
  *display: inline;
  /* IE7 inline-block hack */

*zoom: 1;
  padding: 4px 10px 4px;
  margin-bottom: 0;
  font-size: 13px;
  line-height: 18px;
  color: #333333;
  text-align: center;
  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);
  vertical-align: middle;
  background-color: #f5f5f5;
  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));
  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: linear-gradient(top, #ffffff, #e6e6e6);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);
  border-color: #e6e6e6 #e6e6e6 #bfbfbf;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
  border: 1px solid #cccccc;
  border-bottom-color: #b3b3b3;
  -webkit-border-radius: 4px;
  -moz-border-radius: 4px;
  border-radius: 4px;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  cursor: pointer;
  *margin-left: .3em;
}

.btn:hover,
.btn:active,
.btn.active,
.btn.disabled,
.btn[disabled] {
  background-color: #e6e6e6;
}

.btn:hover {
  color: #333333;
  text-decoration: none;
  background-color: #e6e6e6;
  background-position: 0 -15px;
  -webkit-transition: background-position 0.1s linear;
  -moz-transition: background-position 0.1s linear;
  -ms-transition: background-position 0.1s linear;
  -o-transition: background-position 0.1s linear;
  transition: background-position 0.1s linear;
}

.btn-blue,
.btn-blue:hover,
.btn-yellow,
.btn-yellow:hover,
.btn-red,
.btn-red:hover,
.btn-green,
.btn-green:hover,
.btn-lightblue,
.btn-lightblue:hover,
.btn-black,
.btn-black:hover {
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
  color: #ffffff;
}

.btn-blue {
  background-color: #0074cc;
  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);
  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));
  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);
  background-image: -o-linear-gradient(top, #0088cc, #0055cc);
  background-image: linear-gradient(top, #0088cc, #0055cc);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);
  border-color: #0055cc #0055cc #003580;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}

.btn-blue:hover,
.btn-blue:active,
.btn-blue.active,
.btn-blue.disabled,
.btn-blue[disabled] {
  background-color: #0055cc;
}

.btn-green {
  background-color: #5bb75b;
  background-image: -moz-linear-gradient(top, #62c462, #51a351);
  background-image: -ms-linear-gradient(top, #62c462, #51a351);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));
  background-image: -webkit-linear-gradient(top, #62c462, #51a351);
  background-image: -o-linear-gradient(top, #62c462, #51a351);
  background-image: linear-gradient(top, #62c462, #51a351);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);
  border-color: #51a351 #51a351 #387038;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-green:hover,
.btn-green:active,
.btn-green.active,
.btn-green.disabled,
.btn-green[disabled] {
  background-color: #51a351;
}
.btn-green:active,
.btn-green.active {
  background-color: #408140 ¥9;
}
.btn-lightblue {
  background-color: #49afcd;
  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));
  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: linear-gradient(top, #5bc0de, #2f96b4);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);
  border-color: #2f96b4 #2f96b4 #1f6377;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-lightblue:hover,
.btn-lightblue:active,
.btn-lightblue.active,
.btn-lightblue.disabled,
.btn-lightblue[disabled] {
  background-color: #2f96b4;
}

/* Dialog css */

.motifViewDialog .explanation {
	color: #AAAAAA;
	font-size: 12px;
}

.motifViewDialog .moreInfo {
	color: #3B5998;
	cursor: pointer;
}

.motifViewDialog .basePairs,
.motifViewDialog .extraCopies,
.motifViewDialog .position {
	width: 70px;
}

.motifViewDialog .dialogErrorMessage {
	font-size: 12px;
}

.ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl {
    border-top-left-radius: 1px;
}
.ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr {
    border-top-right-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl {
    border-bottom-left-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br {
    border-bottom-right-radius: 1px;
}

.loadingImageContainer .loadingMessage {
	color: #FF0000;
}

Below is a description of the plug-in function to the GenoCon CAD Application. For the GenoCon2 Special Programming Challenge A, you should replace this with a report of your own program.

Title: MotifMaxCircadian: a plug-in function to the DNA CAD program for Challenge A

Name: RIKEN GenoCon

Affiliation: RIKEN The Institute of Physical and Chemical Research

Date: 2012-10-17

Abstract

The GenoConPromoterCAD program provides several plugin functions for promoter designs. MotifMaxCircadian function picks up the motifs with maximum circadian amplitude. Programmer participants can fork and add to these functions for the GenoCon2 Special Programming Challenge A.