Publish your application｜Mash up the Linked Open Data

forked:PromoterCAD

Save a snapshot
reload

Import an externally hosted application: URL
Check style

save
finish Editing
Cancel

JavaScript
CSS
HTML
Images
Input Data
ReadMe
Snapshots

API Reference (2.0)
Properties

forked:PromoterCAD
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js

history

forked:PromoterCAD
http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css

history

forked:PromoterCAD

history

forked:PromoterCAD

if (typeof Application == "undefined" || !Application) {
	var Application = {};
}

Application.genocon = function() {
	this._init.apply(this, arguments);
};

Application.genocon.prototype = {
	
	CHAR_SEQ_EMPTY : "-",
	
	_baseSequence : null,
	_tooltip : null,
	_methodList : null,
	_appBaseLineSequence : null,
	_appMenuHandler : null,
	
	_default : {
		baseSequenceContainerId : "baseSequenceContainer",
		fixedSequenceClass : "fixedSequence",
		finishSequence : "finishSequence",
		baseErrorMessageClass : "baseErrorMessage",
		errorMessageEnterSequence : "Please enter a sequence of minimum length {0}",
		errorMessageMaximumSequence : "Please enter a sequence of maximum length {0}",
		useButtonClass : "useButton",
		nextButtonClass : "nextButton",
		finishNowButtonClass : "finishNow",
		nextButtonContainerClass : "nextButtonContainer",
		collapseButton : "collapseButton",
		expandButton : "expandButton",
		removeButton : "removeButton",
		appContainerClass : "applicationContainer",
		appDataContainerClass : "applicationDataContainer",
		actionButtonContainer : "actionButtonContainer",
		actionResultContainer : "actionResultContainer",
		baseSequenceBoxClass : "baseSequenceBox",
		baseSequenceClass : "baseSequence",
		selectDataBaseList : "databaseList",
		selectMethodList : "optionList",
		databaseFilteringProperty : "#motif%20sequence",
		methodUrlProperty : "#application%20URL",
		baseSequenceMinLength : 50,
		baseSequenceMaxLength : 500,
		applicationOptionClass : "applicationOptionRadio",
		analysisMethodComboClass : "analysisMethod",
		expressionDbComboClass : "expressionDb",
		dataColomboClass : "dataCol",
		analysisMethodContainer : "analysisMethodContainer",
		expressionDbContainer : "expressionDbContainer",
		dataColContainer : "dataColContainer",
		chkEmptySequenceId : "chkEmptySequnce",
		analysisMethodComboEmptyOptionText : "-- Select Analysis Method --",
		expressionDbComboEmptyOptionText : "-- Select Expression Database --",
		dataColColomboEmptyOptionText : "-- Select Data Collection --",
		manualMotifEntryToolName : "InputMotif",
		itemLabelPostfix : "Label",
		finishSequenceFixedClass : "finishSequenceFixed"
	},
	
	_tag : {
		databaseTag : "database",
		methodTag : "method"
	},
	
	_tooltipName : {
		atGeneExpress : "atgenexpress",
		diurnal : "diurnal",
		selectDatabase : "selectdatabase",
		selectTool : "Select Tool",
		motifExpress : "motifexpress",
		motifCircatian : "motifcircadian",
		motifRank : "motifrank",
		motifQuery : "motifquery",
		defaultSequence : "Base Sequence",
		fixedSequence : "gacccttcctctatataaggaagttcatttcatttggagaggacctcgac",
		finishNow : "Finish Now",
		next : "Next",
		expressionDb : "Expression Database",
		analysisMethod : "Analysis Method",
		dataCollection : "Data Collection",
		baseSequence : "Base Sequence",
		finishNow : "Finish Now",
		startButton : "Start"
	},
	
	_init : function() {
		this._methodList = [];
		this._initToolTip();
		this._initDefaultSequence();
		this._initAppBaseLineSequence();
		this._initLoadScript();
		this._initUseButtonListener();
		this._initAppMenuHanndler();
		this._initAnalysisMethodListener();
		this._initExpressionDbListener();
		this._initDataCollectionListener();
		this._initEmptySequenceCheckBox();
	},
	
	_initToolTip : function() {
		this._tooltip = new Application.tooltip();
	},
	
	_initEmptySequenceCheckBox : function() {
		var self = this;
		$("#" + this._default.chkEmptySequenceId).click(function() {
			if ($(this).is(":checked")) {
				var textArea = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass)
				$(textArea).attr("value","");
				self._fillEmptyBaseSequence();
				$(textArea).attr("disabled",true);
			} else {
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",false);
			}
		});
		/* following two lines were added to correct the behaviour, if user just pressed F5 button to 
           refresh the browser. in that case if previously checkbox is unnchecked, even after pressing
           F5, it remains unchecked in the new window
        */
		$("#" + this._default.chkEmptySequenceId).attr("checked","checked");
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",true);
	},
	
	_initDefaultSequence : function() {
		var self = this;
		this._fillEmptyBaseSequence();
		/*for (var i = 0; i < self._default.baseSequenceMaxLength; i++) {
			sb[sb.length] = self.CHAR_SEQ_EMPTY;
		}
		$baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass);
		$baseInput.val(sb.join(""));*/
		
		$baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass);
		$baseInput.attr("value",$baseInput.val());
		$baseInput.keyup(function() {
			//var size = ($baseInput.val().length != 0) ? $baseInput.val().length : 1;
			//$baseInput.attr("size", size);
			$baseInput.attr("value", $baseInput.val());
		});
		$("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceBoxClass).scrollLeft(10000);
		var timer = new Application.timer();
		var applyToolTip = function() {
			var dToolTip = self._getToolTip(self._tooltipName.defaultSequence);
			var fToolTip = self._getToolTip(self._tooltipName.fixedSequence);
			var toolToolTip = self._getToolTip(self._tooltipName.selectTool);
			var analysisCmbToolTip = self._getToolTip(self._tooltipName.analysisMethod);
			var expDbToolTip = self._getToolTip(self._tooltipName.expressionDb);
			var dataCollToolTip = self._getToolTip(self._tooltipName.dataCollection);
			var startButToolTip = self._getToolTip(self._tooltipName.startButton);
			if (dToolTip && fToolTip) {
				var labelPostfix = self._default.itemLabelPostfix;
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("title", dToolTip);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass + labelPostfix).attr("title", dToolTip);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).attr("title", fToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass).attr("title", analysisCmbToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass + labelPostfix).attr("title", analysisCmbToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass).attr("title", expDbToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass + labelPostfix).attr("title", expDbToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.dataColomboClass).attr("title", dataCollToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.dataColomboClass + labelPostfix).attr("title", dataCollToolTip);
				
				$("." + self._default.appContainerClass + " ." + self._default.selectMethodList).attr("title", toolToolTip);
				$("." + self._default.appContainerClass + " ." + self._default.selectMethodList + labelPostfix).attr("title", toolToolTip);
				
				$(" ." + self._default.useButtonClass).attr("title", startButToolTip);
			} else {
				timer.call(applyToolTip);
			}
		}
		applyToolTip();
	},
	
	_initAppBaseLineSequence : function() {
		this._appBaseLineSequence = new Application.baseLineSequence();
	},
	
	_initAppMenuHanndler : function() {
		this._appMenuHandler = new Application.MenuHandler()
	},
	
	_initLoadScript : function() {
		var self = this;
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileArray){
				$.each(fileArray, function(fileKey, fileName) {
					var getProperties = function(propertytList) {
						$.each(propertytList, function(propKey, propVal) {
							if (propVal.indexOf(self._default.methodUrlProperty) > -1) {
								self._loadPluginScriptList(workId, fileName, propVal);
								return false;
							}
						});
					}
					LinkData.getProperties(workId, fileName, getProperties);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag);
	},
	
	_initDefaultContainer : function() {
		//this._initDatabase();
		this._initMethod();
		this._initActionButton();
		//this._initDatabaseListener();
		this._initMethodListener();
	},
	/*
	_initDatabase : function() {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList);
		$select.attr("title", self._getToolTip(self._tooltipName.selectDatabase));
		$("option", $select).remove();
		$select.append("<option value='-1' selected='selected'>-- Select Database --</option>");
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileArray){
				$.each(fileArray, function(fileKey, fileName) {
					var dbKey = self._getDatabaseOptionKey(workId, fileName);
					var tooltip = self._tooltip.getByKey(fileName);
					$select.append("<option value='" + dbKey + "' title='" + tooltip + "'>" + fileName + "</option>");
				});
			});
		}
		LinkData.getFilesByTag("", self._tag.databaseTag, getFilesByTag);
	},*/
	
	_initMethod : function() {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$("option", $select).remove();
		$select.append("<option value='-1' selected='selected'>-- Select Tool --</option>");
		$select.attr("title", self._getToolTip(self._tooltipName.selectTool));
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileArray){
				$.each(fileArray, function(fileKey, fileName) {
					var getSubjects = function(subjectList) {
						$.each(subjectList, function(subKey, subVal) {
							var label = self._getLabel(subVal);
							var tooltip = self._getToolTipByToolName(label);
							tooltip = (tooltip) ? tooltip : "";
							$select.append("<option value='" + label + "' title='" + tooltip + "'>" + label + "</option>");
							self._methodList.push(label);
						});
					}
					LinkData.getSubjects(workId, fileName, getSubjects);
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag);
	},
	
	_initActionButton : function() {
		var self = this;
		$("." + self._default.actionButtonContainer + " ." + self._default.collapseButton).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.appDataContainerClass).hide();
		});
		$("." + self._default.actionButtonContainer + " ." + self._default.expandButton).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.appDataContainerClass).show();
		});
		$("." + self._default.actionButtonContainer + " ." + self._default.removeButton).click(function() {
			if ($("." + self._default.appContainerClass).length == 1) {
				$("." + self._default.appContainerClass).hide();
				$("." + self._default.appContainerClass + " .actionResultContainer").html("");
				//$("." + self._default.appContainerClass + " .databaseList").find.empty();
				//$("." + self._default.appContainerClass + " .optionList").find('option').remove();
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).show();
			} else {
				$(this).closest("." + self._default.appContainerClass).remove();
			}
		});
	},
	/*
	_initDatabaseListener : function() {
		var self = this;
		var $selectDb = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList);
		$selectDb.change(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.applicationOptionClass).hide();
			$(parent).find("." + self._default.selectMethodList + " option").removeAttr("selected");
			$(parent).find("." + self._default.nextButtonContainerClass).hide();
			$container = $(parent).find("." + self._default.actionResultContainer);
			$container.html("");
			var dbKey = $("option:selected", $(this)).val();
			self._changeMethodList(dbKey);
		});
	},*/
	// tool listner
	_initMethodListener : function() {
		var self = this;
		//var $selectDb = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList);
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$select.change(function() {
			var selectedTool = $(this).val();
			if (selectedTool != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				if (selectedTool == self._default.manualMotifEntryToolName) {
					$(parent).find("." + self._default.applicationOptionClass).hide();
					self._showSelectedPlugin(null,$(this));
				} else {
					//self._clearWorkingArea(this);
					self._initMotifExpressOptions(this);
					self._fillAnalysisMethodCombo(this);
					$(parent).find("." + self._default.analysisMethodContainer).show();
				}
				self._resetDataMiningCombos(this);
				//var comboId = "." + self._default.appContainerClass + " ." + self._default.selectMethodList;
				//self._makeTheDomChangeOfComboSelect(comboId,selectedTool);
			}
		});
	},
	
	_makeTheDomChangeOfComboSelect : function(comboSelecter, value) {
		$(comboSelecter + " option").each(function(i){
        	var optionVal = $(this).val();
			if (optionVal == value) {
				$(this).attr("selected",true);
			}
    	});
	},
	
	_initAnalysisMethodListener : function() {
		var self = this;
		var selecter = "." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass;
		var $select = $(selecter);
		$select.change(function() {
			var selectedAnalysisMethod = $(this).val();
			if (selectedAnalysisMethod != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				self._fillExpressionDBCombo(this);
				self._resetDataMiningCombos(this);
				$(parent).find("." + self._default.expressionDbContainer).show();
				//self._makeTheDomChangeOfComboSelect(selecter, selectedAnalysisMethod);
			}
		});
	},
	
	_initExpressionDbListener : function() {
		var self = this;
		var selector = "." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass
		var $select = $(selector);
		$select.change(function() {
			var selectedExpressionDb = $(this).val();
			if (selectedExpressionDb != "-1") {
				var parent = $(this).closest("." + self._default.appContainerClass);
				self._fillDataCollectionCombo(this);
				self._resetDataMiningCombos(this);
				$(parent).find("." + self._default.dataColContainer).show();
				//self._makeTheDomChangeOfComboSelect(selector, selectedExpressionDb);
			}
		});
	},
	
	_initDataCollectionListener : function() {
		var self = this;
		var selector = "." + self._default.appContainerClass + " ." + self._default.dataColomboClass;
		var $select = $(selector);
		$select.change(function() {
			var selectedDataCollection = $(this).val();
			if (selectedDataCollection != "-1") {
				self._showSelectedPlugin(selectedDataCollection,$(this));
				//self._makeTheDomChangeOfComboSelect(selector, selectedDataCollection)
			}
		});
	},
	
	_getSelectedTool : function(parentRef) {
		return $(parentRef).find("." + this._default.selectMethodList).val();
	},
	
	_getSelectedAnalysisMethod : function(parentRef) {
		var comboRef = $(parentRef).find("." + this._default.analysisMethodComboClass);
		if (comboRef.length > 0 && comboRef.is(":visible")) {
			return $(comboRef).val();
		} else {
			return "";
		}
		//return $(parentRef).find("." + this._default.analysisMethodComboClass).val();
	},
	
	_initMotifExpressOptions : function(context) {
		var self = this;
		var parent = $(context).closest("." + this._default.appContainerClass);
		$(parent).find("." + self._default.applicationOptionClass).unbind('click');
		var selectedTool = $(context).val();
		if (selectedTool == "MotifExpress") {
			$(parent).find("." + self._default.applicationOptionClass).show();
			$(parent).find("." + self._default.applicationOptionClass).click(function() {
				var selectedDataCollection = $(parent).find("." + self._default.dataColomboClass);
				if ($(selectedDataCollection).is(":visible") && $(selectedDataCollection).val() != "-1") {
					self._showSelectedPlugin(selectedDataCollection.val(),$(this));
					//return;
				}	
				//$(parent).find("." + self._default.nextButtonContainerClass).hide();
				//obj.applicationOption = $(this).find("input[name=applicationOption]:checked").val();
				//eval(method)(id, obj);
			});
			// making motif max as the defaukt mthod
			$(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked")[0].checked=true;
		} else {
			$(parent).find("." + self._default.applicationOptionClass).hide();
		}
	},
	
	_resetDataMiningCombos : function(comboRef) {
		var parent = $(comboRef).closest("." + this._default.appContainerClass);
		var expressionDbContainer = $(parent).find("." + this._default.expressionDbContainer);
		var dataColContainer = $(parent).find(" ." + this._default.dataColContainer);
		var analysisMethodContainer = $(parent).find(" ." + this._default.analysisMethodContainer);
		var toolCombo = $(parent).find("." + this._default.selectMethodList);
		var comboClass = $(comboRef).attr("class");
		if (toolCombo.val() == this._default.manualMotifEntryToolName) {
			$(analysisMethodContainer).hide();
			$(expressionDbContainer).hide();
			$(dataColContainer).hide();
		} else {
			if (comboClass == this._default.selectMethodList) {
				$(analysisMethodContainer).show();
				$(expressionDbContainer).hide();
				$(dataColContainer).hide();
			} else if (comboClass == this._default.analysisMethodComboClass) {
				$(expressionDbContainer).hide();
				$(dataColContainer).hide();
			}
			$container = $(parent).find("." + this._default.actionResultContainer);
			$container.html("");
		}
		$(parent).find("." + this._default.finishSequence).hide()
		$(parent).find("." + this._default.finishSequenceFixedClass).hide();
	},
	/*
	_clearWorkingArea : function(context) {
		var parent = $(context).closest("." + this._default.appContainerClass);
		var actionResultArea = $(parent).find("." + this._default.actionResultContainer);
		$(actionResultArea).html("");
	},*/
	
	_showSelectedPlugin : function(selectedDataCollection,context) {
		var self = this;
		var info = null;
		if (selectedDataCollection) {
			info = this._appMenuHandler._getWorkIdAndFileNameUsingDataCollection(selectedDataCollection);
		}
		var parent = $(context).closest("." + this._default.appContainerClass);
		var method = $(parent).find("." + self._default.selectMethodList).val();
		$container = $(parent).find("." + self._default.actionResultContainer);
		$container.html("Loading...");
		//$(parent).find("." + this._default.applicationOptionClass).hide();
		$(parent).find("." + this._default.nextButtonContainerClass).hide();
		var date = new Date();
		var id = "container_id_" + date.getTime();
		var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val();
		var fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).html();
		$container.attr("id", id);
		var func = function() {
			self._callback(parent, self);
		}
		var obj = {
			workId : (info) ? info.workId : "",
			fileName : (info) ? info.fileName : "",
			baseSequence : self._baseSequence,
			tooltip : self._tooltip,
			callback : func,
			applicationOption : appOption,
			fixedSequence : fixedSeq,
			motifMethod : this._getSelectedAnalysisMethod(parent),
			dataColl : selectedDataCollection
		};
		/*
		if (method === "MotifExpress") {
			//$(parent).find("." + self._default.applicationOptionClass).show();
			var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val();
			if (!appOption) {
				appOption = "max";
				$(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption][value='max']").attr("checked", true);
			}
			obj.applicationOption = appOption;
			$(parent).find("." + self._default.applicationOptionClass).unbind('click');
			$(parent).find("." + self._default.applicationOptionClass).click(function() {
				$(parent).find("." + self._default.nextButtonContainerClass).hide();
				$("#" + id).html("");
				obj.applicationOption = $(this).find("input[name=applicationOption]:checked").val();
				eval(method)(id, obj);
			});
		}*/
		eval(method)(id, obj);
	},
	
	_fillAnalysisMethodCombo : function(selectToolCmbRef) {
		var parent = $(selectToolCmbRef).closest("." + this._default.appContainerClass);
		var selectedTool = $(selectToolCmbRef).val();
		var analysisMethods = this._appMenuHandler._getFilteredDistinctAnalysisMethods(selectedTool);
		var analysisMethodCmb = $(parent).find("." + this._default.analysisMethodComboClass);
		this._fillCombo(analysisMethods, analysisMethodCmb, this._default.analysisMethodComboEmptyOptionText, this._tooltipName.analysisMethod);
	},
	
	_fillExpressionDBCombo : function(analysisMethodCmbRef) {
		var parent = $(analysisMethodCmbRef).closest("." + this._default.appContainerClass);
		var selectedTool = this._getSelectedTool(parent);
		var selectedAnalysisMethod = $(analysisMethodCmbRef).val();
		var expressionDbs = this._appMenuHandler._getFilteredDistinctExpressionDbs(selectedTool,selectedAnalysisMethod);
		var analysisMethodCmb = $(parent).find("." + this._default.expressionDbComboClass);
		this._fillCombo(expressionDbs, analysisMethodCmb, this._default.expressionDbComboEmptyOptionText, this._tooltipName.expressionDb);
	},
	
	_fillDataCollectionCombo : function(expressionDbRef) {
		var parent = $(expressionDbRef).closest("." + this._default.appContainerClass);
		var selectedTool = this._getSelectedTool(parent);
		var selectedAnalysisMethod = this._getSelectedAnalysisMethod(parent);
		var selectedExpressionDb = $(expressionDbRef).val();
		var dataCollections = this._appMenuHandler._getFilteredDistinctDataCollections(selectedTool,selectedAnalysisMethod,selectedExpressionDb);
		var dataColCmb = $(parent).find("." + this._default.dataColomboClass);
		this._fillCombo(dataCollections, dataColCmb, this._default.dataColColomboEmptyOptionText, this._tooltipName.dataCollection);
	},
		
	_fillCombo : function(optionsArr, cmbRef, firstOptionText, firstOptionToolTipKey) {
		$(cmbRef).empty();
		var toolTip = this._tooltip.getByKey(firstOptionToolTipKey);
		$(cmbRef).append("<option value='-1' title='"+ toolTip +"'>"+ firstOptionText +"</option>");
		for (var index = 0 ; index < optionsArr.length ; index++) {
			var option = optionsArr[index];
			toolTip = this._tooltip.getByKey(option);
			$(cmbRef).append("<option value='"+ option + "' title='"+ toolTip +"'>"+ option +"</option>");
		}	
	},

_fillEmptyBaseSequence : function() {
		var self = this, sb = [];
		for (var i = 0; i < self._default.baseSequenceMaxLength; i++) {
			sb[sb.length] = self.CHAR_SEQ_EMPTY;
		}
		$baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass);
		$baseInput.val(sb.join(""));
	},
	
	_loadPluginScriptList : function(workId, fileName, property) {
		var getTripleList = function(tripleList) {
			$.each(tripleList, function(tKey, tVal) {
				LinkDataUtil.loadScript(tVal.object);
			});
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTripleList);
	},
	
	_changeMethodList : function(dbKey) {
		var self = this;
		var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList);
		$select.attr("title", self._getToolTip(self._tooltipName.selectTool));
		$("option", $select).remove();
		$select.append("<option value='-1' selected='selected'>-- Select Tool --</option>");
		if (dbKey == -1) {
			return;
		}
		var arr = dbKey.split("|");
		var workId = arr[0];
		var fileName = arr[1];
		$.each(self._methodList, function(key, method) {
			self._addValidMethod($select, workId, fileName, method);
		});
	},
	
	_addValidMethod : function($select, workId, fileName, method) {
		var self = this;
		var getFilesByTag = function(fileList) {
			if (!fileList) {
				return;
			}
			$.each(fileList, function(fKey, fName) {
				if (fName === fileName) {
					var tooltip = self._getToolTipByToolName(method);
					tooltip = (tooltip) ? tooltip : "";
					$select.append("<option value='" + method + "' title='" + tooltip + "'>" + method + "</option>");
					return false;
				}
			});
		}
		LinkData.getFilesByTag(workId, method, getFilesByTag);
	},
	
	_initUseButtonListener : function() {
		var self = this;
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).click(function() {
			self._initDefaultContainer();
			$txtSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass);
			$fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass);
			self._hideError();
			if ($txtSeq.val().length > self._default.baseSequenceMaxLength) {
				self._showError(self._default.errorMessageMaximumSequence.replace("{0}", self._default.baseSequenceMaxLength));
				return;
			}
			if ($txtSeq.val().length < self._default.baseSequenceMaxLength) {
				var tmpVal = $txtSeq.val();
				var eVal = self._getExtraDefaultSequence(self._default.baseSequenceMaxLength - $txtSeq.val().length);
				$txtSeq.val(eVal + tmpVal);
				$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("size", 500);
			}
			self._baseSequence = $txtSeq.val().toString().toLowerCase() + $fixedSeq.html();
			if (!self._baseSequence || self._baseSequence.length < self._default.baseSequenceMinLength) {
				self._showError(self._default.errorMessageEnterSequence.replace("{0}", self._default.baseSequenceMinLength));
			} else {
				//$txtSeq.attr('readonly', true).addClass("noborder");
				$(this).hide();
				$("." + self._default.appContainerClass).show();
				$("." + self._default.appContainerClass + " ." + self._default.expressionDbContainer).hide();
		    	$("." + self._default.appContainerClass + " ." + self._default.dataColContainer).hide();
				$("." + self._default.appContainerClass + " ." + self._default.analysisMethodContainer).hide();
				$("." + self._default.appContainerClass + " ." + self._default.nextButtonContainerClass).hide();
				$("." + self._default.appContainerClass + " ." + self._default.finishSequence).hide()
			}
		});
	},
	
	_callback : function(parent, self) {
		if (self._isSelectedManualMotif(parent)) {
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).hide();
			//self._initNextButtonListener();
		} else {
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).show();
			$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).attr("title", self._getToolTip(self._tooltipName.finishNow));
			self._initFinishNowButtonListener();
		}
		$(parent).find("." + self._default.nextButtonContainerClass).show();
		$(parent).find("." + self._default.finishSequence).hide();
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).attr("title", self._getToolTip(self._tooltipName.next));
		$(parent).find("." + self._default.nextButtonContainerClass).show();
		self._initNextButtonListener();
	},
	
	_isSelectedManualMotif : function(parent) {
		var toolCombo = $(parent).find("." + this._default.selectMethodList);
		var selectedTool = toolCombo.val();
		if (selectedTool == this._default.manualMotifEntryToolName) {
			return true;
		} else {
			return false;
		}
	},
	
	_initNextButtonListener : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).click(function() {
			$parent = $(this).closest("." + self._default.appContainerClass);
			$parent.find("." + self._default.nextButtonContainerClass).hide();
			$(parent).find("." + self._default.finishSequence).hide()
			var clone = $parent.clone(true);
			$(clone).find("." + self._default.applicationOptionClass).hide();
			var text = $(clone).find(".replaceSequence").text();
			if (text && text.trim().length != 0) {
				self._baseSequence = text;
			}
			$(clone).find("." + self._default.actionResultContainer).html("");
			$(clone).find("." + self._default.nextButtonContainerClass).hide();
			$(clone).find("." + self._default.expressionDbContainer).hide();
		    $(clone).find(" ." + self._default.dataColContainer).hide();
			$(clone).find(" ." + self._default.analysisMethodContainer).hide();
			$parent.parent().append(clone);
		});
	},
	
	_initFinishNowButtonListener : function() {
		var self = this;
		$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).unbind('click');
		$("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).click(function() {
			var parent = $(this).closest("." + self._default.appContainerClass);
			$(parent).find("." + self._default.nextButtonContainerClass).hide();
			$(parent).find("." + self._default.finishSequence).hide()
			var gene = $(parent).find(".replaceSequence .gene").val();
			var geneType = $(parent).find(".replaceSequence .geneType").val();
			if (gene && geneType) {
				var callback = function(bSequence) {
					self._showFinishedBaseSequence(parent, bSequence);
				}
				self._appBaseLineSequence.getBaseSequence(gene, geneType, callback);
			} else {
				self._showFinishedBaseSequence(parent,self._baseSequence);
			}
		});
	},
	
	_showFinishedBaseSequence : function(parent, bSequence) {
		var self = this;
		var defaultSequence = $(parent).find(".replaceSequence").text()
		$(parent).find(".wrappedSequenceMotif").hide();	
		var html = self._getFinishedBaseSequence(defaultSequence, bSequence);
		var fixedSequence = self._getFixedSequence();
		$(parent).find("." + self._default.finishSequenceFixedClass).html(fixedSequence);
		$(parent).find("." + self._default.finishSequenceFixedClass).show();
		$(parent).find("." + self._default.finishSequence).show();
		$(parent).find("." + self._default.finishSequence).html(html);
		$(parent).find("." + self._default.finishSequence).scrollLeft(10000);
	},
	
	_getFixedSequence : function() {
		var fixedSequence = $("#" + this._default.baseSequenceContainerId + " ." + this._default.fixedSequenceClass).html();
		return fixedSequence;
	},
	
	_getFinishedBaseSequence : function(defaultSequence, bSequence) {
		var self = this, sb = [];
		var fixedSequence = this._getFixedSequence();
		var uptoFixedSequence = defaultSequence.length - fixedSequence.length;
		for (var i = 0; i < defaultSequence.length; i++) {
			if (i > uptoFixedSequence - 1) {
				continue;
			}
			var dChar = defaultSequence.charAt(i);
			var bChar = bSequence.charAt(i);
			if (bChar) {
				if (dChar !== self.CHAR_SEQ_EMPTY) {
					sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>";
				} else {
					sb[sb.length] = bChar;
				}
			} else {
				sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>";
			}
		}
		return sb.join("");
	},
	
	_getExtraDefaultSequence : function(count) {
		var self = this, sb = [];
		for (var i = 0; i < count; i++) {
			sb[sb.length] = self.CHAR_SEQ_EMPTY;
		}
		return sb.join("");
	},
	
	_getDatabaseOptionKey : function(workId, fileName) {
		return workId + "|" + fileName;
	},
	
	_getLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_showError : function(message) {
		var self = this;
		$errMsgEl = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass);
		$errMsgEl.html(message);
		$errMsgEl.show();
	},
	
	_hideError : function() {
		var self = this;
		$("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass).hide();
	},
	
	_getToolTipByFileName : function(fileName) {
		var self = this;
		if (fileName) {
			if (fileName.toLowerCase().indexOf(self._tooltipName.atGeneExpress) > -1) {
				return self._getToolTip(self._tooltipName.atGeneExpress);
			} else if (fileName.toLowerCase().indexOf(self._tooltipName.diunal) > -1) {
				return self._getToolTip(self._tooltipName.diunal);
			}
		}
	},
	
	_getToolTipByToolName : function(tool) {
		var self = this;
		if (tool) {
			if (tool.toLowerCase().indexOf(self._tooltipName.motifExpress) > -1) {
				return self._getToolTip(self._tooltipName.motifExpress);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifCircatian) > -1) {
				return self._getToolTip(self._tooltipName.motifCircatian);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifRank) > -1) {
				return self._getToolTip(self._tooltipName.motifRank);
			} else if (tool.toLowerCase().indexOf(self._tooltipName.motifQuery) > -1) {
				return self._getToolTip(self._tooltipName.motifQuery);
			}
		}
	},
	
	_getToolTip : function(key) {
		return this._tooltip.getByKey(key);
	}
	
};

Application.MenuHandler = function() {
	this._init.apply(this,arguments);
}

Application.MenuHandler.prototype = {
	
	_fullList : [],
	_currentFilteredList : [],
	_workId : null,
	_fileName : null,
	_fileProperties : null,
	
	_properties : {
		motifAnalysisMethod : "motif%20analysis%20method",
		geneExpressionData : "gene%20expression%20data",
		menuDisplayName : "menu%20display%20name",
		toolsList : "tool%20list",
		workIdInTest : "test.linkdata.org",
		workIdPublic : "linkdata.org",
    },
	
	_tags : {
		menuDataSourceTag : "menu"
	},
	
	_defaults : {
		linkdataTestUrl : "test.linkdata.org",
		linkdataPublicUrl : "linkdata.org",
	},
	
	_init : function(args) {
		this._initMenuDataSource();
	},
	
	_fillFileProperties : function() {
		var self = this;
		var setProperties = function(props) {
			self._fileProperties = props;
		};
		LinkData.getProperties(this._workId,this._fileName,setProperties);
	},
	
	_initMenuDataSource : function() {
		var self = this;
		var foundMenuFiles = [];
		var loadMenuFiles = function(resultList) {
			$.each(resultList, function(wId, fileList) {
				$.each(fileList, function(fileKey, fName) {
					var obj = {
						workId : wId,
						fileName : fName
					};
					foundMenuFiles.push(obj);
				});
			});
			self._foundMenuFiles = foundMenuFiles;
			self._loadMenuFileContent(foundMenuFiles);
			self._fillFileProperties();
		};
		LinkData.getFilesByTag(null, this._tags.menuDataSourceTag, loadMenuFiles);
	},
	
	_loadMenuFileContent : function(menuFiles) {
		var self = this;
		var addFileContent = function(triples) {
			for (var index = 0 ; index < triples.length ; index++) {
				self._fullList.push(triples[index]);
			}
			//if (menuFiles.length > 0) {
			//	self._loadMenuFileContent(menuFiles);
			//}
		};
		if (menuFiles.length > 1) {
			alert("There can be only one file that can be tagged with 'menu'");
			return;
		}
		if (menuFiles.length == 0) {
			return;
		}
		var obj = menuFiles.shift(); // removing the first element
		this._fileName = obj.fileName;
		this._workId = obj.workId;
		LinkData.getTriples(this._workId,this._fileName,addFileContent,{start:1, end:2000});
	},
	
	
	_getFilteredAnalysisMethodTriples : function(toolName) {
		if (!(toolName)) return this._fullList;
		this._currentFilteredList = [];
		var listByTool = this._getTriplesByProperty(this._properties.toolsList,this._fullList);
		if (!listByTool) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByTool.length ; index++) {
			var triple = listByTool[index];
			if (triple.object) {
				var toolList = triple.object.split(",");
				for (var index1 = 0 ; index1 < toolList.length ; index1++) {
					var tool = toolList[index1];
					if (tool.trim() == toolName.trim()) {
						var subject = triple.subject;
						var otherPropTripleList = this._getTriplesBySubject(subject);
						for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
							var propTriple = otherPropTripleList[index1];
							//this._currentFilteredList.push(propTriple);
							filteredList.push(propTriple);
						}
						break;
					}
				}
			}
		}
	    return filteredList;
		/*this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.motifAnalysisMethod);
		return distinctList;*/
	},
	
	_getFilteredDistinctAnalysisMethods : function(toolName) {
		var filteredList = this._getFilteredAnalysisMethodTriples(toolName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.motifAnalysisMethod,filteredList);
		return distinctList;
	},
		
	_getFilteredExpressionDbTriples : function(toolName,analysisMethodName) {
		var listByTool = this._getFilteredAnalysisMethodTriples(toolName);
		var listByAnalysisMethod = this._getTriplesByProperty(this._properties.motifAnalysisMethod,listByTool);
		if (!listByAnalysisMethod) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByAnalysisMethod.length ; index++) {
			var triple = listByAnalysisMethod[index];
			if (triple.object) {
				var analysisMethod = triple.object;
				if (analysisMethod.trim() == analysisMethodName.trim()) {
					var subject = triple.subject;
					var otherPropTripleList = this._getTriplesBySubject(subject);
					for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
						var propTriple = otherPropTripleList[index1];
						//this._currentFilteredList.push(propTriple);
						filteredList.push(propTriple);
					}
				}
			}
		}
		return filteredList
		/*this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.geneExpressionData);
		return distinctList;*/
	},
	
	_getFilteredDistinctExpressionDbs : function(toolName,analysisMethodName) {
		var filteredList = this._getFilteredExpressionDbTriples(toolName,analysisMethodName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.geneExpressionData,filteredList);
		return distinctList;
	},
		
	_getFilteredDataCollectionTriples : function(toolName,analysisMethodName,expressionDbName) {
		var listByExpDbs = this._getFilteredExpressionDbTriples(toolName,analysisMethodName);
		var listByGeneExp = this._getTriplesByProperty(this._properties.geneExpressionData,listByExpDbs);
		if (!listByGeneExp) return null;
		var filteredList = [];
		for (var index = 0 ; index < listByGeneExp.length ; index++) {
			var triple = listByGeneExp[index];
			if (triple.object) {
				var exprssionDb = triple.object;
				if (exprssionDb.trim() == expressionDbName.trim()) {
					var subject = triple.subject;
					var otherPropTripleList = this._getTriplesBySubject(subject);
					for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
						var propTriple = otherPropTripleList[index1];
						//this._currentFilteredList.push(propTriple);
						filteredList.push(propTriple);
					}
				}
			}
		}
		return filteredList;
		/*this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.menuDisplayName);
		return distinctList;*/
	},
		
	_getFilteredDistinctDataCollections : function(toolName,analysisMethodName,expressionDbName) {
		var filteredList = this._getFilteredDataCollectionTriples(toolName,analysisMethodName,expressionDbName);
		this._currentFilteredList = filteredList;
		var distinctList = this._getDistinctObjectList(this._properties.menuDisplayName,filteredList);
		return distinctList;
	},
	
	_getWorkIdAndFileNameUsingDataCollection : function(dataCollectionName) {
		var matchingList = [];
		var outObj = null;
		var listByDataCollection = this._getTriplesByProperty(this._properties.menuDisplayName,this._currentFilteredList);
		if (!listByDataCollection) return null;
		for (var index = 0 ; index < listByDataCollection.length ; index++) {
			var triple = listByDataCollection[index];
			var dataCollection = triple.object;
			if (dataCollection == dataCollectionName) {
				matchingList.push(triple);
			}
		}
		if (matchingList.length > 1) {
			// this a error. because there can be only one matching triple
			alert("Data file error");
		} else {
			// getting other triples for found one
			var subject = matchingList.shift().subject;
			var workId = null;
			var otherPropTripleList = this._getTriplesBySubject(subject);
			var workIdProperty = this._getWorkIdProperty();
			for (var index=0 ; index < otherPropTripleList.length ; index++) {
				var triple = otherPropTripleList[index];
				var prop = this._getProperty(triple.property);
				if (prop == workIdProperty) {
					workId = triple.object;
					break;
				}
			}
			var workIdComps = workId.split("/");
			var subjectComps = subject.split("#");
			outObj = {
				fileName : subjectComps[subjectComps.length-1],
				workId : workIdComps[workIdComps.length-1],
			};
		}
		return outObj;
	},
	
	_getProperty : function(propertyUrl) {
		var comps = propertyUrl.split("#");
		return comps[comps.length-1];
	},
	
	_getWorkIdProperty : function() {
		var hostName = window.location.hostname;
		if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) {
			return this._properties.workIdInTest;
		} else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) {
			return this._properties.workIdPublic;
		}
	},
	
	_getTriplesByProperty : function(propName,currentList) {
		/*
          this function first will find the triple with the passed property and then
		  this will take the subject of it and will find other properties of that
          subject
		*/
		var filteredList = [];
		//var currentList = this._getCurrentUsingList();
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var prop = this._getProperty(triple.property);
			if (prop == propName) {
				filteredList.push(triple);
				//var otherPropTripleList = this._getTriplesBySubject(subject);
				//for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) {
				//	var propTriple = otherPropTripleList[index1];
				//	filteredList.push(propTriple);
				//}
			}
		}
		return filteredList;
	},
	
	_getTriplesBySubject : function(subject) {
		var filteredList = [];
		var currentList = this._getCurrentUsingList();
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var triSubject = triple.subject;
			if (triSubject.trim() == subject.trim()) {
				filteredList.push(triple);
			}
			if (filteredList.length == this._fileProperties.length) {
				break;
			}
		}
		return filteredList;
	},
	
	// returns a string array
	_getDistinctObjectList : function(propName,currentList) {
		var distinctList = [];
		for (var index = 0 ; index < currentList.length ; index++) {
			var triple = currentList[index];
			var prop = triple.property;
			if (prop && prop.indexOf(propName) != -1) {
				var objVal = triple.object;
				if (distinctList.indexOf(objVal) == -1) {
					distinctList.push(objVal);
				}
			}
		}
		return distinctList;
	},
	
	_getCurrentUsingList : function() {
		if (this._currentFilteredList.length == 0) {
			return this._fullList;
		} else {
			return this._currentFilteredList;
		}
	},
}
	
Application.baseLineSequence = function() {
	this._init.apply(this, arguments);
};

Application.baseLineSequence.prototype = {
	
	_attedSequenceInfo : null,
	_ppdbSequenceInfo : null,
	
	_default : {
		sequenceProperty : "baseline%20sequence"
	},
	
	_tag : {
		attedBaseSequenceTag : "atted_baseLineSequence",
		ppdbBaseSequenceTag : "ppdb_baseLineSequence"
	},
	
	_init : function() {
		this._attedSequenceInfo = {};
		this._ppdbSequenceInfo = {};
		this._initBaseSequenceFile();
	},
	
	_initBaseSequenceFile : function() {
		this._initAttedBaseSequenceFile();
		this._initPpdbBaseSequenceFile();
	},
	
	_initAttedBaseSequenceFile : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initAttedInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.attedBaseSequenceTag, getFilesByTag);
	},
	
	_initPpdbBaseSequenceFile : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initPpdbInfo(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._tag.ppdbBaseSequenceTag, getFilesByTag);
	},
	
	_initAttedInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._attedSequenceInfo.workId = workId;
					self._attedSequenceInfo.fileName = fileName;
					self._attedSequenceInfo.property = pValue;
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_initPpdbInfo : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				var propOnly = pValue.split("#")[1];
				if (propOnly == self._default.sequenceProperty) {
					self._ppdbSequenceInfo.workId = workId;
					self._ppdbSequenceInfo.fileName = fileName;
					self._ppdbSequenceInfo.property = pValue;
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getAttedSubjectUrl : function(gene) {
		return "http://atted.jp/data/locus/" + gene + ".html";
	},
	
	_getPpdbSubjectUrl : function(gene) {
		return "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene;
	},
	
	_getAttedBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._attedSequenceInfo.workId;
		var fileName = self._attedSequenceInfo.fileName;
		var property = self._attedSequenceInfo.property;
		var subject = self._getAttedSubjectUrl(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	},
	
	_getPpdbBaseSequence : function(gene, callback) {
		var self = this;
		var workId = self._ppdbSequenceInfo.workId;
		var fileName = self._ppdbSequenceInfo.fileName;
		var property = self._ppdbSequenceInfo.property;
		var subject = self._getPpdbSubjectUrl(gene);
		var getObjects = function(objList) {
			callback(objList[0]);
		}
		LinkData.getObjects(workId, fileName, subject, property, getObjects);
	},
	
	getBaseSequence : function(gene, geneType, callback) {
		var self = this;
		if ("ATTED" === geneType) {
			self._getAttedBaseSequence(gene, callback);
		} else if ("PPDB" === geneType) {
			self._getPpdbBaseSequence(gene, callback);
		} else {
			// error
		}
	}
	
};

Application.tooltip = function() {
	this._init.apply(this, arguments);
};

Application.tooltip.prototype = {
	
	_toolTipList : null,
	
	_default : {
		explanationProperty : "explanation"
	},
	
	_init : function() {
		this._toolTipList = [];
		this._initToolTip();
	},
	
	_initToolTip : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._getFilePropertyList(workId, fileName);
				});
			});
		}
		LinkData.getFilesByTag(null, "tooltip", getFilesByTag);
	},
	
	_getFilePropertyList : function(workId, fileName) {
		var self = this;
		var index = new Application.index(1, 10000);
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				if (pValue.indexOf(self._default.explanationProperty) > -1) {
					self._getSubjectList(workId, fileName, pValue, index);
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getSubjectList : function(workId, fileName, property, index) {
		var self = this;
		var getSubjects = function(subjectList) {
			self._getPropertyList(subjectList, workId, fileName, property, index);
		}
		LinkData.getSubjects(workId, fileName, getSubjects, index);
	},
	
	_getPropertyList : function(subjectList, workId, fileName, property, index) {
		var self = this;
		var getTriplesByProperty = function(tripleList) {
			self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index);
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index);
	},
	
	_addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) {
		var self = this;
		for (var i = 0; i < subjectList.length; i++) {
			var key = self._getLabelAfterHash(subjectList[i]);
			if (tripleList[i]) {
				var value = tripleList[i].object;
				self._addToolTip(key, value);
			}
			//var value = tripleList[i].object;
			//self._addToolTip(key, value);
		}
		if (subjectList && subjectList.length == index.getItemCount()) {
			self._getSubjectList(workId, fileName, property, index.increment());
		}
	},
	
	_addToolTip : function(key, tooltip) {
		var obj = {};
		obj.key = key;
		obj.tooltip = tooltip;
		this._toolTipList.push(obj);
	},
	
	getByKey : function(key) {
		var self = this, tooltip;
		$.each(self._toolTipList, function(objKey, obj) {
			if (obj.key.toString().toLowerCase() === key.toString().toLowerCase()) {
				tooltip = obj.tooltip;
				return false;
			}
		});
		return (tooltip) ? tooltip : "";
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
	
};

Application.index = function() {
	this._init.apply(this, arguments);
}

Application.index.prototype = {
	
	_start : null,
	_end : null,
	
	_init : function(start, end) {
		this._start = start;
		this._end = end;
	},
	
	getIndex : function() {
		return {start : this._start, end : this._end};
	},
	
	getItemCount : function() {
		return (this._end - this._start + 1);
	},
	
	increment : function() {
		var itemCount = this.getItemCount();
		this._start = this._start + itemCount;
		this._end = this._end + itemCount;
		return {start : this._start, end : this._end};
	},
	
	getStartIndex : function() {
		return this._start;
	},
	
	getEndIndex : function() {
		return this._end;
	}
	
};

Application.timer = function() {
	this._init.apply(this, arguments);
};

Application.timer.prototype = {
	
	_delay : null,
	_retry : null,
	_maxRetry : null,
	
	_init : function() {
		this._delay = 1000;
		this._retry = 0;
		this._maxRetry = 100;
	},
	
	call : function(func) {
		if (this._retry < this._maxRetry) {
			setTimeout(func, this._delay);
		}
		this._retry++;
	},
	
	setMaxRetryCount : function(no) {
		this._maxRetry = no;
	}
};

Application.MotifConflication = function() {
	this._init.apply(this, arguments);
};

/*
Application.MotifConflication.prototype = {
	
	_motifConflictConfirmDialogId : null,
	_containerId : null,
	_resultAreaClass : "resultArea",
	_baseSequenceLength : 550,
	_baseSequence : null,
	_appSequence : null,
	replaceSequenceClass : "replaceSequence",
	htmlRenderFunction : null,
	htmlSetFunctionOwner : null,
	
	defaults : {
		conflictionDialogTitle : "Confliction",	
	},
	
	_init : function(para,appSequnce) {
		//this._containerId = para;
		this._containerId = para;
		//this._resultAreaClass = para.resutAreaClass;
		//this._baseSequenceLength = para.baseSequenceLength;
		//this._appSequence = appSequnce; 
	},
	
	_setAppSequnce : function(appSequence) {
		this._appSequence = appSequence;	
	},
	
	_setHtmlSetFunction  : function(func) {
		this.htmlRenderFunction = func;
	},
	
	_setHtmlSetFunctionOwner : function(owner) {
		this.htmlSetFunctionOwner = owner;
	},
	
	_initConflictConfirmDialogView : function() {
		var sb = [], date = new Date(); 
		//self._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + self._containerId + "_" + date.getTime();
		this._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + date.getTime();
		sb[sb.length] = "<div id='" + this._motifConflictConfirmDialogId + "' class='hidden' style='width:200px'>";
		sb[sb.length] = "<div>New motif overlaps with old one. Which one should be kept in overalp regions?</div>";
		sb[sb.length] = "<div class='option'>";
		sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='new'/>&nbsp;New</label></div>";
		sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='old'/>&nbsp;Old</label></div>";
		sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='discard'/>&nbsp;Discard new motif</label></div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<label><input type='checkbox' checked=checked class='motifReplaceApplyToAllMotifMax' value='applytoall'/>&nbsp;Apply to all</label>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "</div>";
		$("#" + this._containerId).append(sb.join(""));
		console.log(this._containerId);
	},
	
	_initMotifConflictConfirmDialog : function() {
		var self = this;
		$("#" + self._motifConflictConfirmDialogId).dialog({
			autoOpen: false,
			width: 420,
			dialogClass : "motifConflictionDialog"
		});
	},
	
	_handleConfliction : function(conflictArray) {
		var self = this;
		if (conflictArray.length > 0) {
			var arr = conflictArray[0].split("|");
			var bArray = self._getConflictConfirmDialogButtonArray(conflictArray);
			var dialogTitle =  this.defaults.conflictionDialogTitle + " - " +  arr[0] + "[" + arr[1] + "]";
			$("#" + self._motifConflictConfirmDialogId).find("input[name='motifReplaceOption'][value='new']").attr("checked", "checked");
			var checkBox = $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMax']");
			$(checkBox).attr("checked",$(checkBox).is(':checked'));
			//$("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked");
			$("#" + self._motifConflictConfirmDialogId).dialog({title : dialogTitle});
			$("#" + self._motifConflictConfirmDialogId).dialog({buttons : bArray});
			$("#" + self._motifConflictConfirmDialogId).dialog("open");
		} else {
			$("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMax']").attr("checked", "checked");	
		}
	},
	
	_getConflictConfirmDialogButtonArray : function(conflictArray) {
		var self = this;
		return [
				{
					text: "Done",
					click : function() {
						$(this).dialog("close");
						var option = $(this).find("input[name='motifReplaceOption']:checked").val();
						var isApplyToAll = $(this).find(".motifReplaceApplyToAll").is(":checked");
						self._replaceWithOption(option, isApplyToAll, conflictArray);
					}
				},
				{
					text: "Cancel",
					click : function() {
						$(this).dialog("close");
					}
				}
			];
	},
	
	_replaceWithOption : function(option, isApplyToAll, conflictArray) {
		var self = this;
		if (isApplyToAll) {
			self._replaceAllWithOption(option, conflictArray);
			$("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked");
		} else {
			var value = conflictArray.splice(0, 1);
			var arr = value[0].split("|");
			self._replaceSequenceByOption(option, arr[0], arr[1]);
			self._handleConfliction(conflictArray);
		}
	},
	
	_replaceAllWithOption : function(option, conflictArray) {
		var self = this, html = oldSequence;
		var oldSequence = $("#" + self._containerId + " ." + self.replaceSequenceClass).text();
		if (!oldSequence) {
			oldSequence = $("#" + self._containerId + " ." + self.resultAreaClass + " .baseSequence").html();
		}
		$.each(conflictArray, function(key, conflict) {
			var arr = conflict.split("|");
			self._replaceSequenceByOption(option, arr[0], arr[1]);
		});
	},
	
	_replaceSequenceByOption : function(option, seq, pos) {
		var self = this;
		var oldSequence = $("#" + self._containerId + " ." + self.replaceSequenceClass).text();
		if (!oldSequence) {
			oldSequence = $("#" + self._containerId + " ." + self.resultAreaClass + " .baseSequence").html();
		}
		var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequenceLength, seq, pos);
		var seqArray = [formattedSeq];
		var newSequence = self._appSequence._getMergeCharSequence(seqArray);
		var html = oldSequence;
		if (option === "new") {
			html = self._appSequence.getHtmlByReplacingNewSequence(oldSequence, newSequence);
		} else if (option === "old") {
			html = self._appSequence.getHtmlByReplacingOldSequence(oldSequence, newSequence);
		}
		//self._doReplaceWithHtml(html);
		self.htmlRenderFunction.call(html);
	},
	
	_hasConfliction : function(seq, pos, oldSequence) {
		var self = this;
		if (!oldSequence) {
			oldSequence = $("#" + self._containerId + " ." + self._resultAreaClass + " .baseSequence").html();
		}
		var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequenceLength, seq, pos);
		var array = [formattedSeq];
		var newSequence = self._appSequence._getMergeCharSequence(array);
		for (var i = 0; i < oldSequence.length; i++) {
			var oChar = oldSequence.charAt(i);
			var nChar = newSequence.charAt(i);
			if (nChar !== "-" && oChar !== "-" && nChar !== oChar) {
				return true;
			}
		}
		return false;
	},
}
*/
$(document).ready(function() {
	new Application.genocon();
});

body {
    font-family: sans-serif;
    font-size: 14px;
}

a {
    color: #3B5998;
    font-weight: bold;
    text-decoration: none;
}

#gcAppContainer {
	width: 900px;
}

.hidden {
	display:none;
}

.left {
    float: left;
}

.label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    min-width: 165px;
}

input.baseSequence {
	/*width: 100%;*/
}

.highlight-sequence {
	font-weight: bold;
}

.resultArea {
    font-family: "Courier New","Lucida Console";
    margin: 10px 0;
    min-width: 410px;
    overflow: auto;
    width: 100%;
	background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
	white-space: nowrap;
}

.resultArea .userSequence {
	white-space: nowrap;
	float: left;
}

.finishSequence,
.replaceSequenc {
   background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    margin: 10px 0 0;
	font-family: "Courier New","Lucida Console";
	width: 100%;
	overflow: auto;
	white-space: nowrap;
}

.wrappedSequenceMotif {
	background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    margin: 10px 0 0;
	font-family: "Courier New","Lucida Console";
	overflow: auto;
	word-wrap: break-word;
	white-space: normal;
	width:100%;
	height:90px;
	word-break: break-all;
}

.replace {
    color: #E80010;
}

.baseErrorMessage,
.errorMessage {
	color: black;
	/*text-align: center;*/
	margin-bottom: -10px;
    margin-top: 10px;
}

.errorText {
	color: #FF0000;
}

.applicationContainer {
    background-color: #F6F6F6;
    border: 1px solid #CCCCCC;
    margin: 5px 0 0;
    padding: 5px;
}

.actionButtonContainer {
    text-align: right;
}

.actionBtn {
    border: 1px solid #DDDDDD;
    cursor: pointer;
    display: inline-block;
    font-weight: bold;
    padding: 5px 2px;
    text-align: center;
    width: 25px;
}

.row {
    padding: 5px 0;
}
.row:after {
    clear: left;
    content: "";
    display: block;
}
.row input[type="text"] {
    width: 200px;
}

.row .externalLink {
	margin: 0 5px;
}

.noborder {
    border: medium none;
}

#baseSequenceContainer .baseSequenceBox {
	width: 100%;
	overflow: auto;
	white-space: nowrap;
}
#baseSequenceContainer .baseSequenceBox span,
#baseSequenceContainer .baseSequenceBox .baseSequence {
	font-family: Courier;
}

#baseSequenceContainer .baseSequenceBox .fixedSequence {
	position: relative;
	left: -6px;
	color: #AAAAAA;
	font-weight: bold;
}

.applicationContainer .nextButtonContainer {
	margin-top: 10px;
}

.databaseInfo .motif {
	width: 70%;
}

/**
 * button css
 */

a.useButton {
	width: 150px;
}

.actionBtn {
	border: 1px solid #DDDDDD;
    cursor: pointer;
    display: inline-block;
    font-weight: bold;
    padding: 5px 2px;
    text-align: center;
    width: 25px;
}

.actionBtn:hover {
	border: 1px solid #000000;
}

.btn {
  display: inline-block;
  *display: inline;
  /* IE7 inline-block hack */

*zoom: 1;
  padding: 4px 10px 4px;
  margin-bottom: 0;
  font-size: 13px;
  line-height: 18px;
  color: #333333;
  text-align: center;
  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);
  vertical-align: middle;
  background-color: #f5f5f5;
  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));
  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: linear-gradient(top, #ffffff, #e6e6e6);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);
  border-color: #e6e6e6 #e6e6e6 #bfbfbf;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
  border: 1px solid #cccccc;
  border-bottom-color: #b3b3b3;
  -webkit-border-radius: 4px;
  -moz-border-radius: 4px;
  border-radius: 4px;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  cursor: pointer;
  *margin-left: .3em;
}

.btn:hover,
.btn:active,
.btn.active,
.btn.disabled,
.btn[disabled] {
  background-color: #e6e6e6;
}

.btn:hover {
  color: #333333;
  text-decoration: none;
  background-color: #e6e6e6;
  background-position: 0 -15px;
  -webkit-transition: background-position 0.1s linear;
  -moz-transition: background-position 0.1s linear;
  -ms-transition: background-position 0.1s linear;
  -o-transition: background-position 0.1s linear;
  transition: background-position 0.1s linear;
}

.btn-blue,
.btn-blue:hover,
.btn-yellow,
.btn-yellow:hover,
.btn-red,
.btn-red:hover,
.btn-green,
.btn-green:hover,
.btn-lightblue,
.btn-lightblue:hover,
.btn-black,
.btn-black:hover {
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
  color: #ffffff;
}

.btn-blue {
  background-color: #0074cc;
  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);
  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));
  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);
  background-image: -o-linear-gradient(top, #0088cc, #0055cc);
  background-image: linear-gradient(top, #0088cc, #0055cc);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);
  border-color: #0055cc #0055cc #003580;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}

.btn-blue:hover,
.btn-blue:active,
.btn-blue.active,
.btn-blue.disabled,
.btn-blue[disabled] {
  background-color: #0055cc;
}

.btn-green {
  background-color: #5bb75b;
  background-image: -moz-linear-gradient(top, #62c462, #51a351);
  background-image: -ms-linear-gradient(top, #62c462, #51a351);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));
  background-image: -webkit-linear-gradient(top, #62c462, #51a351);
  background-image: -o-linear-gradient(top, #62c462, #51a351);
  background-image: linear-gradient(top, #62c462, #51a351);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);
  border-color: #51a351 #51a351 #387038;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-green:hover,
.btn-green:active,
.btn-green.active,
.btn-green.disabled,
.btn-green[disabled] {
  background-color: #51a351;
}
.btn-green:active,
.btn-green.active {
  background-color: #408140 ¥9;
}
.btn-lightblue {
  background-color: #49afcd;
  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));
  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: linear-gradient(top, #5bc0de, #2f96b4);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);
  border-color: #2f96b4 #2f96b4 #1f6377;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-lightblue:hover,
.btn-lightblue:active,
.btn-lightblue.active,
.btn-lightblue.disabled,
.btn-lightblue[disabled] {
  background-color: #2f96b4;
}

/* Dialog css */

.motifViewDialog .explanation {
	color: #AAAAAA;
	font-size: 12px;
	margin-left: 200px;
}

.motifViewDialog .moreInfo {
	color: #3B5998;
	cursor: pointer;
}

.motifViewDialog .position {
	width: 70px;
}

.motifViewDialog .dialogErrorMessage {
	font-size: 12px;
}

.ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl {
    border-top-left-radius: 1px;
}
.ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr {
    border-top-right-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl {
    border-bottom-left-radius: 1px;
}
.ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br {
    border-bottom-right-radius: 1px;
}

.loadingImageContainer .loadingMessage {
	color: #FF0000;
}

.motifConflictionDialog .option {
	margin: 10px;
}

.motifViewDialog {
	margin-top: 10px;	
}

.motifViewDialog .label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    width : 200px;
}

.motifViewDialog .motifviewinfo {
	float: right;
    margin-top: -150px;
    position: relative;
    width: 350px;	
}

.deletelink {
	cursor: pointer;	
}

.deletelink img {
	margin-bottom: -3px;	
}

.manualMotifView .manualMotifViewInfo {
	float: right;
    height: 90px;
    margin-right: 10px;
    margin-top: -65px;
    position: relative;
    width: 380px;
}

.baseSequenceBox textarea {
	resize: none;	
	width: 490px;
	height: 115px;
}

.fixedSequenceCheckBox {
	float: right;
    margin-right: 210px;
    margin-top: -115px;
}

.fixedSequenceMsg {
	float: right;
    margin-right: 20px;
    margin-top: -40px;
}

.fixedSequenceMotif {
	display: inline;
    float: right;
    font-family: "Courier New","Lucida Console";
    margin-top: -15px;
}

.resultAreaUserMessageClass {
	color: #0A5DA6;
    font: bold 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    font-size: 12px;
    font-weight: bold;
    margin-top: -6px;
	margin-bottom: 4px;
}

.finishSequence {
	 background-color: #FFFFFF;
    border: 1px solid #DDDDDD;
    font-family: "Courier New","Lucida Console";
    height: 100px;
    margin: 10px 0 0;
    overflow: auto;
    width: 480px;
    word-break: break-all;
    word-wrap: break-word;
	white-space: normal;
}

.finishSequenceFixed {
	display: inline;
    float: right;
    font-family: "Courier New","Lucida Console";
    margin-top: -15px;
}

.manualsequence {
	float: right;
    height: 40px;
    overflow: auto;
    width: 300px;
	margin-bottom: 5px;
}

.motifviewsequence {
	float: right;
    height: 40px;
    margin-bottom: 5px;
    overflow: auto;
    width: 240px;
}

<div id="baseSequenceContainer">
	<div class="label baseSequenceLabel">Base Sequence</div>
	<div class="baseSequenceBox">
		<span>
			<textarea type="text" cols=45 rows=5 class="baseSequence" value="" disabled=true maxlength=500> </textarea>
		</span>
		
		<span class="fixedSequence">GATCCCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG</span>
	</div>
	<div>
		<div class="fixedSequenceCheckBox"><input type="checkbox" id="chkEmptySequnce" value="true" checked=true>Start with empty sequence</div>
		<div class="fixedSequenceMsg">Minimal Promoter (fixed)</div>
	</div>
	<div style="margin-top:5px;"><a class="useButton btn btn-green">Start promoter design</a></div>
	<div class="baseErrorMessage hidden"></div>
</div>
<div class="applicationContainer hidden">
	<div class="actionButtonContainer">
		<span class="appSummery"></span>
		<span class="collapseButton actionBtn" title="collapse">_</span>
		<span class="expandButton actionBtn" title="expand">+</span>
		<span class="removeButton actionBtn" title="remove">x</span>
		<br clear="all"/>
	</div>
	<div class="applicationDataContainer">
		
		<div class="row">
			<div class="label left optionListLabel">Select Tool</div>
			<div class="left">
				<select class="optionList"></select>
				<span class="applicationOptionRadio hidden">
					<input type="radio" name="applicationOption" value="max" checked="checked"/>&nbsp;Max
					<input type="radio" name="applicationOption" value="min"/>&nbsp;Min
				</span>
			</div>
		</div>

<div class="row hidden analysisMethodContainer">
			<div class="label left analysisMethodLabel">Analysis Method</div>
			<div class="left">
				<select class="analysisMethod"></select>
			</div>
		</div>
		
		<div class="row hidden expressionDbContainer">
			<div class="label left expressionDbLabel">Expression DataBase</div>
			<div class="left">
				<select class="expressionDb"></select>
			</div>
		</div>
		
		<div class="row hidden dataColContainer">
			<div class="label left dataColLabel">Data Collection</div>
			<div class="left">
				<select class="dataCol"></select>
			</div>
		</div>
		
		<div class="actionResultContainer"></div>
		<div class="nextButtonContainer hidden">
			<a class="btn nextButton">Next</a>
			<a class="btn finishNow">Finish Now</a>
		</div>
		<div class="finishSequence hidden"></div>
		<div class="finishSequenceFixed hidden"></div>
	</div>
</div>
</div>

Select Input Data

LinkData Work	Table Data
Speedup Lists of Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Gene	DiurnalHours_ATTED_0to4_top DiurnalHours_ATTED_12to16_top DiurnalHours_ATTED_16to20_top DiurnalHours_ATTED_20to24_top DiurnalHours_ATTED_4to8_top DiurnalHours_ATTED_8to12_top DiurnalHours_ATTED_all DiurnalHours_ATTED_bottom DiurnalHours_ATTED_top
my Application Plugins for Synthetic Promoter Design - new	Application_Plugins_for_Synthetic_Promoter_Design_new
Speedup Lists of Developmental Genomic (AtGenExpress + PPDB promoter motif) Gene	AtGenExpress_PPDB_all AtGenExpress_PPDB_bottom AtGenExpress_PPDB_top
PromoterCAD_tooltips	tooltip_AtGenExpress tooltip_DataTable tooltip_PromoterCAD_menus_buttons
Developmental Genomic (AtGenExpress + PPDB promoter motif) Full	AtGenExpress_PPDB_Flowering AtGenExpress_PPDB_Fruit_Seeds AtGenExpress_PPDB_Leaf AtGenExpress_PPDB_Root AtGenExpress_PPDB_Seedling AtGenExpress_PPDB_Stem AtGenExpress_PPDB_Whole_Plant Octamer_elements
my PromoterCAD Data Tables	PromoterCAD_Data_Tables
Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Full	DiurnalHours_ATTED_COL_LDHH DiurnalHours_ATTED_COL_SD DiurnalHours_ATTED_DD_DDHC DiurnalHours_ATTED_LDHC DiurnalHours_ATTED_LDHH_SM DiurnalHours_ATTED_LDHH_ST DiurnalHours_ATTED_LER_SD DiurnalHours_ATTED_LIGHT5_HIF138_13 DiurnalHours_ATTED_LIGHT5_HIF138_8 DiurnalHours_ATTED_LIGHT5_znknOX DiurnalHours_ATTED_LL12_LDHH DiurnalHours_ATTED_LL23_LDHH DiurnalHours_ATTED_LLHC DiurnalHours_ATTED_LL_LDHC DiurnalHours_ATTED_LL_LLHC DiurnalHours_ATTED_lhyox_SD DiurnalHours_ATTED_longday DiurnalHours_ATTED_lux_2_LDHH DiurnalHours_ATTED_phyB9_SD DiurnalHours_ATTED_shortday
Circadian Genomic (DIURNAL + PPDB promoter motif) Full	DiurnalHours_PPDB_COL_LDHH DiurnalHours_PPDB_COL_SD DiurnalHours_PPDB_DD_DDHC DiurnalHours_PPDB_LDHC DiurnalHours_PPDB_LDHH_SM DiurnalHours_PPDB_LDHH_ST DiurnalHours_PPDB_LER_SD DiurnalHours_PPDB_LIGHT5_HIF138_13 DiurnalHours_PPDB_LIGHT5_HIF138_8 DiurnalHours_PPDB_LIGHT5_znknOX DiurnalHours_PPDB_LL12_LDHH DiurnalHours_PPDB_LL23_LDHH DiurnalHours_PPDB_LLHC DiurnalHours_PPDB_LL_LDHC DiurnalHours_PPDB_LL_LLHC DiurnalHours_PPDB_lhyox_SD DiurnalHours_PPDB_longday DiurnalHours_PPDB_lux_2_LDHH DiurnalHours_PPDB_phyB9_SD DiurnalHours_PPDB_shortday
ATTED promoter sequence	ATTED_promoter_sequence
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full	AtGenExpress_ATTED_Flowering AtGenExpress_ATTED_Fruit_Seeds AtGenExpress_ATTED_Leaf AtGenExpress_ATTED_Root AtGenExpress_ATTED_Seedling AtGenExpress_ATTED_Stem AtGenExpress_ATTED_Whole_Plant Heptamer_elements PPDB_position
Speedup Lists of Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Gene	AtGenExpress_ATTED_all AtGenExpress_ATTED_bottom AtGenExpress_ATTED_top
Speedup Lists of Circadian Genomic (DIURNAL + PPDB promoter motif) Gene	DiurnalHours_PPDB_0to4_top DiurnalHours_PPDB_12to16_top DiurnalHours_PPDB_16to20_top DiurnalHours_PPDB_20to24_top DiurnalHours_PPDB_4to8_top DiurnalHours_PPDB_8to12_top DiurnalHours_PPDB_all DiurnalHours_PPDB_bottom DiurnalHours_PPDB_top
PPDB promoter sequence	PPDB_promoter_sequence

Add LinkData work(LinkData)

<p class="report"></p>
<p class="report">
<i class="report">
Below is a description of the PromoterCAD Application. 
</i>
<br class="report">
</p>
<p class="report">
<br class="report">
</p>
<h1 class="report" align="CENTER">
Title: Synthetic Plant Promoter Design for Tissue/Time Specific Expression of Firefly Luciferase in Arabidopsis Plant Body
</h1>
<p class="report" align="CENTER">
<b class="report">
Name: RIKEN GenoCon
</b>
</p>
<p class="report" align="CENTER">
<b class="report">
Affiliation: RIKEN The Institute of Physical and Chemical Research
</b>
</p>
<p class="report" align="CENTER">
Date: 2013-01-17
</p>
<h2 class="report">
Abstract
</h2>
<p class="report">
PromoterCAD uses plant gene sequence and expression data to create synthetic promoters for tissue and time specific expression. The experimental test of such synthetic promoters will be to measure firefly Luciferase in <i class="report">Arabidopsis</i> plant body. The program provides a graphical user interface (GUI), so anyone can design promoters using options in a series of select menus and push buttons. The program is written in JavaScript, on an open platform that allows for easy user customization. 
</p>
<br class="report">
<p class="report">
The program provides several plugin tools for promoter designs MotifExpress, and MotifCircadian function, as well as <a class="report" href="http://app.linkdata.org/app/app1s152i">LocusSelect</a> function for graph visualization of expression data. <a class="report" href="http://app.linkdata.org/app/app1s150i">MotifExpress</a> picks up the sequence motifs from the gene with maximum/minimum expression in a specific developmental condition or time of day. <a class="report" href="http://app.linkdata.org/app/app1s151i">MotifCircadian</a> picks up the motifs with maximum circadian amplitude. Output includes visualization such as <a class="report" href="http://www.highcharts.com/">HighCharts</a> graph visualization of expression data under experimental conditions (<a class="report" href="http://arabidopsis.org/servlets/TairObject?type=expression_set&id=1006710873">AtGenExpress</a>) and time evolution of expression under circadian conditions (<a class="report" href="http://diurnal.mocklerlab.org/about">DIURNAL</a>). Programmers can easily fork and add to these functions following the PromoterCAD manuals and help pages:
</p>
<p class="report">
<br class="report">
</p>
<p class="report">
For detail of GenoCon2 Promoter Design Challenge, please see the <a class="report" href="http://genocon.org/assignment-2012/assignment-a/">Promoter Design Challenge</a> page.
If you are ready to submit a design to GenoCon2, please check the manual for <a class="report" href="https://hackpad.com/GenoCon2--Promoter-Design-Submission-A1acQF0EkFe">Promoter Design Submission</a>.
If you want to learn more about the PromoterCAD software and data, check out the <a class="report" href="http://promotercad.org">PromoterCAD homepage</a>.
</p>
<p class="report">
</p>

Click the Browse button or drag and drop to choose files to upload