Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
PromoterCAD Beginning Tutorial 1 - example application
useful
0
Loading...
if (typeof Application == "undefined" || !Application) { var Application = {}; } Application.genocon = function() { this._init.apply(this, arguments); }; Application.genocon.prototype = { CHAR_SEQ_EMPTY : "-", _baseSequence : null, _tooltip : null, _methodList : null, _appBaseLineSequence : null, _appMenuHandler : null, _default : { baseSequenceContainerId : "baseSequenceContainer", fixedSequenceClass : "fixedSequence", finishSequence : "finishSequence", finishSequenceContainer : "finishSequenceContainer", baseErrorMessageClass : "baseErrorMessage", errorMessageEnterSequence : "Please enter a sequence of minimum length {0}", errorMessageMaximumSequence : "Please enter a sequence of maximum length {0}", useButtonClass : "useButton", nextButtonClass : "nextButton", finishNowButtonClass : "finishNow", nextButtonContainerClass : "nextButtonContainer", collapseButton : "collapseButton", expandButton : "expandButton", removeButton : "removeButton", appContainerClass : "applicationContainer", appDataContainerClass : "applicationDataContainer", actionButtonContainer : "actionButtonContainer", actionResultContainer : "actionResultContainer", baseSequenceBoxClass : "baseSequenceBox", baseSequenceClass : "baseSequence", selectDataBaseList : "databaseList", selectMethodList : "optionList", databaseFilteringProperty : "#motif%20sequence", methodUrlProperty : "#application%20URL", baseSequenceMinLength : 50, baseSequenceMaxLength : 500, //applicationOptionClass : "applicationOptionRadio", analysisMethodComboClass : "analysisMethod", expressionDbComboClass : "expressionDb", dataColomboClass : "dataCol", analysisMethodContainer : "analysisMethodContainer", expressionDbContainer : "expressionDbContainer", dataColContainer : "dataColContainer", chkEmptySequenceId : "chkEmptySequnce", analysisMethodComboEmptyOptionText : "-- Select Analysis Method --", expressionDbComboEmptyOptionText : "-- Select Expression Database --", dataColColomboEmptyOptionText : "-- Select Data Collection --", manualMotifEntryToolName : "InputMotif", itemLabelPostfix : "Label", finishSequenceFixedClass : "finishSequenceFixed", repeatButtonClass : "repeatAgain" }, _tag : { databaseTag : "database", methodTag : "method" }, _tooltipName : { atGeneExpress : "atgenexpress", diurnal : "diurnal", selectDatabase : "selectdatabase", selectTool : "Select Tool", motifExpress : "motifexpress", motifCircatian : "motifcircadian", motifRank : "motifrank", motifQuery : "motifquery", inputMotif : "inputmotif", defaultSequence : "Base Sequence", fixedSequence : "gacccttcctctatataaggaagttcatttcatttggagaggacctcgac", finishNow : "Finish Now", next : "Next", expressionDb : "Expression Database", analysisMethod : "Analysis Method", dataCollection : "Data Collection", baseSequence : "Base Sequence", finishNow : "Finish Now", startButton : "Start" }, _init : function() { this._methodList = []; this._initToolTip(); this._initDefaultSequence(); this._initAppBaseLineSequence(); this._initLoadScript(); this._initUseButtonListener(); this._initAppMenuHanndler(); this._initAnalysisMethodListener(); this._initExpressionDbListener(); this._initDataCollectionListener(); this._initEmptySequenceCheckBox(); }, _initToolTip : function() { this._tooltip = new Application.tooltip(); }, _initEmptySequenceCheckBox : function() { var self = this; $("#" + this._default.chkEmptySequenceId).click(function() { if ($(this).is(":checked")) { var textArea = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass) $(textArea).attr("value",""); self._fillEmptyBaseSequence(); $(textArea).attr("disabled",true); } else { $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",false); } }); /* following two lines were added to correct the behaviour, if user just pressed F5 button to refresh the browser. in that case if previously checkbox is unnchecked, even after pressing F5, it remains unchecked in the new window */ $("#" + this._default.chkEmptySequenceId).attr("checked","checked"); $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",true); }, _initDefaultSequence : function() { var self = this; this._fillEmptyBaseSequence(); $baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass); $baseInput.attr("value",$baseInput.val()); $baseInput.keyup(function() { $baseInput.attr("value", $baseInput.val()); }); $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceBoxClass).scrollLeft(10000); var timer = new Application.timer(); var applyToolTip = function() { var dToolTip = self._getToolTip(self._tooltipName.defaultSequence); var fToolTip = self._getToolTip(self._tooltipName.fixedSequence); var toolToolTip = self._getToolTip(self._tooltipName.selectTool); var analysisCmbToolTip = self._getToolTip(self._tooltipName.analysisMethod); var expDbToolTip = self._getToolTip(self._tooltipName.expressionDb); var dataCollToolTip = self._getToolTip(self._tooltipName.dataCollection); var startButToolTip = self._getToolTip(self._tooltipName.startButton); if (dToolTip && fToolTip) { var labelPostfix = self._default.itemLabelPostfix; $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("title", dToolTip); $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass + labelPostfix).attr("title", dToolTip); $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).attr("title", fToolTip); $("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass).attr("title", analysisCmbToolTip); $("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass + labelPostfix).attr("title", analysisCmbToolTip); $("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass).attr("title", expDbToolTip); $("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass + labelPostfix).attr("title", expDbToolTip); $("." + self._default.appContainerClass + " ." + self._default.dataColomboClass).attr("title", dataCollToolTip); $("." + self._default.appContainerClass + " ." + self._default.dataColomboClass + labelPostfix).attr("title", dataCollToolTip); $("." + self._default.appContainerClass + " ." + self._default.selectMethodList).attr("title", toolToolTip); $("." + self._default.appContainerClass + " ." + self._default.selectMethodList + labelPostfix).attr("title", toolToolTip); $(" ." + self._default.useButtonClass).attr("title", startButToolTip); } else { timer.call(applyToolTip); } } applyToolTip(); }, _initAppBaseLineSequence : function() { this._appBaseLineSequence = new Application.baseLineSequence(); }, _initAppMenuHanndler : function() { this._appMenuHandler = new Application.MenuHandler() }, _initLoadScript : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var getProperties = function(propertytList) { $.each(propertytList, function(propKey, propVal) { if (propVal.indexOf(self._default.methodUrlProperty) > -1) { self._loadPluginScriptList(workId, fileName, propVal); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); return false; }); }); } LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag); }, _initDefaultContainer : function() { this._initMethod(); this._initActionButton(); this._initMethodListener(); }, _initMethod : function() { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Tool --</option>"); $select.attr("title", self._getToolTip(self._tooltipName.selectTool)); var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var getSubjects = function(subjectList) { $.each(subjectList, function(subKey, subVal) { var label = self._getLabel(subVal); var tooltip = self._getToolTipByToolName(label); tooltip = (tooltip) ? tooltip : ""; $select.append("<option value='" + label + "' title='" + tooltip + "'>" + label + "</option>"); self._methodList.push(label); }); } LinkData.getSubjects(workId, fileName, getSubjects); }); }); } LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag); }, _initActionButton : function() { var self = this; $("." + self._default.actionButtonContainer + " ." + self._default.collapseButton).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.appDataContainerClass).hide(); }); $("." + self._default.actionButtonContainer + " ." + self._default.expandButton).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.appDataContainerClass).show(); }); $("." + self._default.actionButtonContainer + " ." + self._default.removeButton).click(function() { if ($("." + self._default.appContainerClass).length == 1) { $("." + self._default.appContainerClass).hide(); $("." + self._default.appContainerClass + " .actionResultContainer").html(""); $("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).show(); } else { $(this).closest("." + self._default.appContainerClass).remove(); } }); }, // tool listner _initMethodListener : function() { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $select.change(function() { var selectedTool = $(this).val(); if (selectedTool != "-1") { var parent = $(this).closest("." + self._default.appContainerClass); if (selectedTool == self._default.manualMotifEntryToolName) { //$(parent).find("." + self._default.applicationOptionClass).hide(); self._showSelectedPlugin(null,$(this)); } else { //self._clearWorkingArea(this); //self._initMotifExpressOptions(this); self._fillAnalysisMethodCombo(this); $(parent).find("." + self._default.analysisMethodContainer).show(); } self._resetDataMiningCombos(this); } }); }, _makeTheDomChangeOfComboSelect : function(comboSelecter, value) { $(comboSelecter + " option").each(function(i){ var optionVal = $(this).val(); if (optionVal == value) { $(this).attr("selected",true); } }); }, _initAnalysisMethodListener : function() { var self = this; var selecter = "." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass; var $select = $(selecter); $select.change(function() { var selectedAnalysisMethod = $(this).val(); if (selectedAnalysisMethod != "-1") { var parent = $(this).closest("." + self._default.appContainerClass); self._fillExpressionDBCombo(this); self._resetDataMiningCombos(this); $(parent).find("." + self._default.expressionDbContainer).show(); } }); }, _initExpressionDbListener : function() { var self = this; var selector = "." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass var $select = $(selector); $select.change(function() { var selectedExpressionDb = $(this).val(); if (selectedExpressionDb != "-1") { var parent = $(this).closest("." + self._default.appContainerClass); self._fillDataCollectionCombo(this); self._resetDataMiningCombos(this); $(parent).find("." + self._default.dataColContainer).show(); } }); }, _initDataCollectionListener : function() { var self = this; var selector = "." + self._default.appContainerClass + " ." + self._default.dataColomboClass; var $select = $(selector); $select.change(function() { var selectedDataCollection = $(this).val(); if (selectedDataCollection != "-1") { self._showSelectedPlugin(selectedDataCollection,$(this)); } }); }, _getSelectedTool : function(parentRef) { return $(parentRef).find("." + this._default.selectMethodList).val(); }, _getSelectedAnalysisMethod : function(parentRef) { var comboRef = $(parentRef).find("." + this._default.analysisMethodComboClass); if (comboRef.length > 0 && comboRef.is(":visible")) { return $(comboRef).val(); } else { return ""; } }, /* _initMotifExpressOptions : function(context) { var self = this; var parent = $(context).closest("." + this._default.appContainerClass); //$(parent).find("." + self._default.applicationOptionClass).unbind('click'); var selectedTool = $(context).val(); if (selectedTool == "MotifExpress") { $(parent).find("." + self._default.applicationOptionClass).show(); $(parent).find("." + self._default.applicationOptionClass).click(function() { var selectedDataCollection = $(parent).find("." + self._default.dataColomboClass); if ($(selectedDataCollection).is(":visible") && $(selectedDataCollection).val() != "-1") { self._showSelectedPlugin(selectedDataCollection.val(),$(this)); //return; } }); // making motif max as the defaukt mthod $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked")[0].checked=true; } else { $(parent).find("." + self._default.applicationOptionClass).hide(); } },*/ _resetDataMiningCombos : function(comboRef) { var parent = $(comboRef).closest("." + this._default.appContainerClass); var expressionDbContainer = $(parent).find("." + this._default.expressionDbContainer); var dataColContainer = $(parent).find(" ." + this._default.dataColContainer); var analysisMethodContainer = $(parent).find(" ." + this._default.analysisMethodContainer); var toolCombo = $(parent).find("." + this._default.selectMethodList); var comboClass = $(comboRef).attr("class"); if (toolCombo.val() == this._default.manualMotifEntryToolName) { $(analysisMethodContainer).hide(); $(expressionDbContainer).hide(); $(dataColContainer).hide(); } else { if (comboClass == this._default.selectMethodList) { $(analysisMethodContainer).show(); $(expressionDbContainer).hide(); $(dataColContainer).hide(); } else if (comboClass == this._default.analysisMethodComboClass) { $(expressionDbContainer).hide(); $(dataColContainer).hide(); } $container = $(parent).find("." + this._default.actionResultContainer); $container.html(""); } $(parent).find("." + this._default.finishSequenceContainer).hide() //$(parent).find("." + this._default.finishSequenceFixedClass).hide(); }, _showSelectedPlugin : function(selectedDataCollection,context) { var self = this; var info = null; if (selectedDataCollection) { info = this._appMenuHandler._getSelectedDbInfoUsingDataCollection(selectedDataCollection); } var parent = $(context).closest("." + this._default.appContainerClass); var method = $(parent).find("." + self._default.selectMethodList).val(); var analysisMethod = $(parent).find("." + self._default.analysisMethodComboClass).val(); $container = $(parent).find("." + self._default.actionResultContainer); $container.html("Loading..."); //$(parent).find("." + this._default.applicationOptionClass).hide(); $(parent).find("." + this._default.nextButtonContainerClass).hide(); var date = new Date(); var id = "container_id_" + date.getTime(); //var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val(); var fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).html(); $container.attr("id", id); var func = function() { self._callback(parent, self); } var obj = { workId : (info) ? info.workId : "", fileName : (info) ? info.fileName : "", rankListWorkId : (info) ? info.rankListWorkId : "", baseSequence : self._baseSequence, tooltip : self._tooltip, callback : func, //applicationOption : appOption, fixedSequence : fixedSeq, motifMethod : this._getSelectedAnalysisMethod(parent), dataColl : selectedDataCollection, analysisMethod : analysisMethod }; eval(method)(id, obj); }, _fillAnalysisMethodCombo : function(selectToolCmbRef) { var parent = $(selectToolCmbRef).closest("." + this._default.appContainerClass); var selectedTool = $(selectToolCmbRef).val(); var analysisMethods = this._appMenuHandler._getFilteredDistinctAnalysisMethods(selectedTool); var analysisMethodCmb = $(parent).find("." + this._default.analysisMethodComboClass); this._fillCombo(analysisMethods, analysisMethodCmb, this._default.analysisMethodComboEmptyOptionText, this._tooltipName.analysisMethod); }, _fillExpressionDBCombo : function(analysisMethodCmbRef) { var parent = $(analysisMethodCmbRef).closest("." + this._default.appContainerClass); var selectedTool = this._getSelectedTool(parent); var selectedAnalysisMethod = $(analysisMethodCmbRef).val(); var expressionDbs = this._appMenuHandler._getFilteredDistinctExpressionDbs(selectedTool,selectedAnalysisMethod); var analysisMethodCmb = $(parent).find("." + this._default.expressionDbComboClass); this._fillCombo(expressionDbs, analysisMethodCmb, this._default.expressionDbComboEmptyOptionText, this._tooltipName.expressionDb); }, _fillDataCollectionCombo : function(expressionDbRef) { var parent = $(expressionDbRef).closest("." + this._default.appContainerClass); var selectedTool = this._getSelectedTool(parent); var selectedAnalysisMethod = this._getSelectedAnalysisMethod(parent); var selectedExpressionDb = $(expressionDbRef).val(); var dataCollections = this._appMenuHandler._getFilteredDistinctDataCollections(selectedTool,selectedAnalysisMethod,selectedExpressionDb); var dataColCmb = $(parent).find("." + this._default.dataColomboClass); this._fillCombo(dataCollections, dataColCmb, this._default.dataColColomboEmptyOptionText, this._tooltipName.dataCollection); }, _fillCombo : function(optionsArr, cmbRef, firstOptionText, firstOptionToolTipKey) { $(cmbRef).empty(); var toolTip = this._tooltip.getByKey(firstOptionToolTipKey); $(cmbRef).append("<option value='-1' title='"+ toolTip +"'>"+ firstOptionText +"</option>"); for (var index = 0 ; index < optionsArr.length ; index++) { var option = optionsArr[index]; toolTip = this._tooltip.getByKey(option); $(cmbRef).append("<option value='"+ option + "' title='"+ toolTip +"'>"+ option +"</option>"); } }, _fillEmptyBaseSequence : function() { var self = this, sb = []; for (var i = 0; i < self._default.baseSequenceMaxLength; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } $baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass); $baseInput.val(sb.join("")); }, _loadPluginScriptList : function(workId, fileName, property) { var getTripleList = function(tripleList) { $.each(tripleList, function(tKey, tVal) { LinkDataUtil.loadScript(tVal.object); }); } LinkData.getTriplesByProperty(workId, fileName, property, getTripleList); }, _changeMethodList : function(dbKey) { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $select.attr("title", self._getToolTip(self._tooltipName.selectTool)); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Tool --</option>"); if (dbKey == -1) { return; } var arr = dbKey.split("|"); var workId = arr[0]; var fileName = arr[1]; $.each(self._methodList, function(key, method) { self._addValidMethod($select, workId, fileName, method); }); }, _addValidMethod : function($select, workId, fileName, method) { var self = this; var getFilesByTag = function(fileList) { if (!fileList) { return; } $.each(fileList, function(fKey, fName) { if (fName === fileName) { var tooltip = self._getToolTipByToolName(method); tooltip = (tooltip) ? tooltip : ""; $select.append("<option value='" + method + "' title='" + tooltip + "'>" + method + "</option>"); return false; } }); } LinkData.getFilesByTag(workId, method, getFilesByTag); }, _initUseButtonListener : function() { var self = this; $("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).click(function() { self._initDefaultContainer(); $txtSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass); $fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass); self._hideError(); if ($txtSeq.val().length > self._default.baseSequenceMaxLength) { self._showError(self._default.errorMessageMaximumSequence.replace("{0}", self._default.baseSequenceMaxLength)); return; } if ($txtSeq.val().length < self._default.baseSequenceMaxLength) { var tmpVal = $txtSeq.val(); var eVal = self._getExtraDefaultSequence(self._default.baseSequenceMaxLength - $txtSeq.val().length); $txtSeq.val(eVal + tmpVal); $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("size", 500); } self._baseSequence = $txtSeq.val().toString().toLowerCase() + $fixedSeq.html(); if (!self._baseSequence || self._baseSequence.length < self._default.baseSequenceMinLength) { self._showError(self._default.errorMessageEnterSequence.replace("{0}", self._default.baseSequenceMinLength)); } else { //$txtSeq.attr('readonly', true).addClass("noborder"); $(this).hide(); $("." + self._default.appContainerClass).show(); $("." + self._default.appContainerClass + " ." + self._default.expressionDbContainer).hide(); $("." + self._default.appContainerClass + " ." + self._default.dataColContainer).hide(); $("." + self._default.appContainerClass + " ." + self._default.analysisMethodContainer).hide(); $("." + self._default.appContainerClass + " ." + self._default.nextButtonContainerClass).hide(); $("." + self._default.appContainerClass + " ." + self._default.finishSequenceContainer).hide() } }); }, _callback : function(parent, self) { if (self._isSelectedManualMotif(parent)) { $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).hide(); $("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).hide(); //self._initNextButtonListener(); } else { $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).show(); $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).attr("title", self._getToolTip(self._tooltipName.finishNow)); $("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).show(); self._initFinishNowButtonListener(); } $(parent).find("." + self._default.nextButtonContainerClass).show(); $(parent).find("." + self._default.finishSequenceContainer).hide(); $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).attr("title", self._getToolTip(self._tooltipName.next)); $(parent).find("." + self._default.nextButtonContainerClass).show(); self._initNextButtonListener(); self._initRepeatButtonListner(); }, _isSelectedManualMotif : function(parent) { var toolCombo = $(parent).find("." + this._default.selectMethodList); var selectedTool = toolCombo.val(); if (selectedTool == this._default.manualMotifEntryToolName) { return true; } else { return false; } }, _initNextButtonListener : function() { var self = this; $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).unbind('click'); $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).click(function() { $parent = $(this).closest("." + self._default.appContainerClass); $parent.find("." + self._default.nextButtonContainerClass).hide(); $($parent).find("." + self._default.finishSequenceContainer).hide() var clone = $parent.clone(true); //$(clone).find("." + self._default.applicationOptionClass).hide(); var text = $(clone).find(".replaceSequence").text(); if (text && text.trim().length != 0) { self._baseSequence = text; } $(clone).find("." + self._default.actionResultContainer).html(""); $(clone).find("." + self._default.nextButtonContainerClass).hide(); $(clone).find("." + self._default.expressionDbContainer).hide(); $(clone).find(" ." + self._default.dataColContainer).hide(); $(clone).find(" ." + self._default.analysisMethodContainer).hide(); $parent.parent().append(clone); }); }, _initFinishNowButtonListener : function() { var self = this; $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).unbind('click'); $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.nextButtonContainerClass).hide(); $(parent).find("." + self._default.finishSequenceContainer).hide() var gene = $(parent).find(".replaceSequence .gene").val(); var geneType = $(parent).find(".replaceSequence .geneType").val(); if (gene && geneType) { var callback = function(bSequence) { self._showFinishedBaseSequence(parent, bSequence); } //self._appBaseLineSequence.getBaseSequence(gene, geneType, callback); self._appBaseLineSequence._getBaseSequence(gene, callback); } else { self._showFinishedBaseSequence(parent,self._baseSequence); } }); }, _initRepeatButtonListner : function() { var self = this; $("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).unbind('click'); $("." + self._default.appContainerClass + " ." + self._default.repeatButtonClass).click(function() { $parent = $(this).closest("." + self._default.appContainerClass); $parent.find("." + self._default.nextButtonContainerClass).hide(); $($parent).find("." + self._default.finishSequenceContainer).hide() var clone = $parent.clone(true); var text = $(clone).find(".replaceSequence").text(); if (text && text.trim().length != 0) { self._baseSequence = text; } $(clone).find("." + self._default.actionResultContainer).html(""); $(clone).find("." + self._default.nextButtonContainerClass).hide(); // setting the values var tool = $($parent).find("." + self._default.selectMethodList).val(); var expressionDb = $($parent).find("." + self._default.expressionDbComboClass).val(); //var dataCollection = $($parent).find("." + self._default.dataColomboClass).val(); var analysisMethod = $($parent).find("." + self._default.analysisMethodComboClass).val(); $(clone).find("." + self._default.selectMethodList).val(tool); $(clone).find("." + self._default.expressionDbComboClass).val(expressionDb); //$(clone).find(" ." + self._default.dataColomboClass).val(dataCollection); $(clone).find(" ." + self._default.analysisMethodComboClass).val(analysisMethod); $parent.parent().append(clone); }); }, _showFinishedBaseSequence : function(parent, bSequence) { var self = this; var defaultSequence = $(parent).find(".replaceSequence").text() $(parent).find(".wrappedSequenceMotif").hide(); var html = self._getFinishedBaseSequence(defaultSequence, bSequence); var fixedSequence = self._getFixedSequence(); $(parent).find("." + self._default.finishSequenceContainer).show(); $(parent).find("." + self._default.finishSequenceFixedClass).html(fixedSequence); //$(parent).find("." + self._default.finishSequenceFixedClass).show(); $(parent).find("." + self._default.finishSequence).html(html); $(parent).find("." + self._default.finishSequence).scrollLeft(10000); }, _getFixedSequence : function() { var fixedSequence = $("#" + this._default.baseSequenceContainerId + " ." + this._default.fixedSequenceClass).html(); return fixedSequence; }, _getFinishedBaseSequence : function(defaultSequence, bSequence) { var self = this, sb = []; var fixedSequence = this._getFixedSequence(); var uptoFixedSequence = defaultSequence.length - fixedSequence.length; for (var i = 0; i < defaultSequence.length; i++) { if (i > uptoFixedSequence - 1) { continue; } var dChar = defaultSequence.charAt(i); var bChar = bSequence.charAt(i); if (bChar) { if (dChar !== self.CHAR_SEQ_EMPTY) { sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>"; } else { sb[sb.length] = bChar.toLowerCase(); } } else { sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>"; } } return sb.join(""); }, _getExtraDefaultSequence : function(count) { var self = this, sb = []; for (var i = 0; i < count; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } return sb.join(""); }, _getDatabaseOptionKey : function(workId, fileName) { return workId + "|" + fileName; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _showError : function(message) { var self = this; $errMsgEl = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass); $errMsgEl.html(message); $errMsgEl.show(); }, _hideError : function() { var self = this; $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass).hide(); }, _getToolTipByFileName : function(fileName) { var self = this; if (fileName) { if (fileName.toLowerCase().indexOf(self._tooltipName.atGeneExpress) > -1) { return self._getToolTip(self._tooltipName.atGeneExpress); } else if (fileName.toLowerCase().indexOf(self._tooltipName.diunal) > -1) { return self._getToolTip(self._tooltipName.diunal); } } }, _getToolTipByToolName : function(tool) { var self = this; if (tool) { if (tool.toLowerCase().indexOf(self._tooltipName.motifExpress) > -1) { return self._getToolTip(self._tooltipName.motifExpress); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifCircatian) > -1) { return self._getToolTip(self._tooltipName.motifCircatian); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifRank) > -1) { return self._getToolTip(self._tooltipName.motifRank); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifQuery) > -1) { return self._getToolTip(self._tooltipName.motifQuery); } else if (tool.toLowerCase().indexOf(self._tooltipName.inputMotif) > -1) { return self._getToolTip(self._tooltipName.inputMotif); } } }, _getToolTip : function(key) { return this._tooltip.getByKey(key); } }; Application.MenuHandler = function() { this._init.apply(this,arguments); } Application.MenuHandler.prototype = { _fullList : [], _currentFilteredList : [], _workId : null, _fileName : null, _fileProperties : null, _properties : { motifAnalysisMethod : "motif%20analysis%20method", geneExpressionData : "gene%20expression%20data", menuDisplayName : "menu%20display%20name", toolsList : "tool%20list", workIdInTest : "test.linkdata.org", workIdPublic : "linkdata.org", ranklistWorkIdTest : "rank%20list%20test.linkdata.org", ranklistWorkIdPublic : "rank%20list%20linkdata.org" }, _tags : { menuDataSourceTag : "menu" }, _defaults : { linkdataTestUrl : "test.linkdata.org", linkdataPublicUrl : "linkdata.org", }, _init : function(args) { this._initMenuDataSource(); }, _fillFileProperties : function() { var self = this; var setProperties = function(props) { self._fileProperties = props; }; LinkData.getProperties(this._workId,this._fileName,setProperties); }, _initMenuDataSource : function() { var self = this; var foundMenuFiles = []; var loadMenuFiles = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { var obj = { workId : wId, fileName : fName }; foundMenuFiles.push(obj); }); }); self._foundMenuFiles = foundMenuFiles; self._loadMenuFileContent(foundMenuFiles); self._fillFileProperties(); }; LinkData.getFilesByTag(null, this._tags.menuDataSourceTag, loadMenuFiles); }, _loadMenuFileContent : function(menuFiles) { var self = this; var addFileContent = function(triples) { for (var index = 0 ; index < triples.length ; index++) { self._fullList.push(triples[index]); } }; if (menuFiles.length > 1) { alert("There can be only one file that can be tagged with 'menu'"); return; } if (menuFiles.length == 0) { return; } var obj = menuFiles.shift(); // removing the first element this._fileName = obj.fileName; this._workId = obj.workId; LinkData.getTriples(this._workId,this._fileName,addFileContent,{start:1, end:2000}); }, _getFilteredAnalysisMethodTriples : function(toolName) { if (!(toolName)) return this._fullList; this._currentFilteredList = []; var listByTool = this._getTriplesByProperty(this._properties.toolsList,this._fullList); if (!listByTool) return null; var filteredList = []; for (var index = 0 ; index < listByTool.length ; index++) { var triple = listByTool[index]; if (triple.object) { var toolList = triple.object.split(","); for (var index1 = 0 ; index1 < toolList.length ; index1++) { var tool = toolList[index1]; if (tool.trim() == toolName.trim()) { var subject = triple.subject; var otherPropTripleList = this._getTriplesBySubject(subject); for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) { var propTriple = otherPropTripleList[index1]; //this._currentFilteredList.push(propTriple); filteredList.push(propTriple); } break; } } } } return filteredList; }, _getFilteredDistinctAnalysisMethods : function(toolName) { var filteredList = this._getFilteredAnalysisMethodTriples(toolName); this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.motifAnalysisMethod,filteredList); return distinctList; }, _getFilteredExpressionDbTriples : function(toolName,analysisMethodName) { var listByTool = this._getFilteredAnalysisMethodTriples(toolName); var listByAnalysisMethod = this._getTriplesByProperty(this._properties.motifAnalysisMethod,listByTool); if (!listByAnalysisMethod) return null; var filteredList = []; for (var index = 0 ; index < listByAnalysisMethod.length ; index++) { var triple = listByAnalysisMethod[index]; if (triple.object) { var analysisMethod = triple.object; if (analysisMethod.trim() == analysisMethodName.trim()) { var subject = triple.subject; var otherPropTripleList = this._getTriplesBySubject(subject); for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) { var propTriple = otherPropTripleList[index1]; //this._currentFilteredList.push(propTriple); filteredList.push(propTriple); } } } } return filteredList }, _getFilteredDistinctExpressionDbs : function(toolName,analysisMethodName) { var filteredList = this._getFilteredExpressionDbTriples(toolName,analysisMethodName); this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.geneExpressionData,filteredList); return distinctList; }, _getFilteredDataCollectionTriples : function(toolName,analysisMethodName,expressionDbName) { var listByExpDbs = this._getFilteredExpressionDbTriples(toolName,analysisMethodName); var listByGeneExp = this._getTriplesByProperty(this._properties.geneExpressionData,listByExpDbs); if (!listByGeneExp) return null; var filteredList = []; for (var index = 0 ; index < listByGeneExp.length ; index++) { var triple = listByGeneExp[index]; if (triple.object) { var exprssionDb = triple.object; if (exprssionDb.trim() == expressionDbName.trim()) { var subject = triple.subject; var otherPropTripleList = this._getTriplesBySubject(subject); for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) { var propTriple = otherPropTripleList[index1]; //this._currentFilteredList.push(propTriple); filteredList.push(propTriple); } } } } return filteredList; }, _getFilteredDistinctDataCollections : function(toolName,analysisMethodName,expressionDbName) { var filteredList = this._getFilteredDataCollectionTriples(toolName,analysisMethodName,expressionDbName); this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.menuDisplayName,filteredList); return distinctList; }, _getSelectedDbInfoUsingDataCollection : function(dataCollectionName) { var matchingList = []; var outObj = null; var listByDataCollection = this._getTriplesByProperty(this._properties.menuDisplayName,this._currentFilteredList); if (!listByDataCollection) return null; for (var index = 0 ; index < listByDataCollection.length ; index++) { var triple = listByDataCollection[index]; var dataCollection = triple.object; if (dataCollection == dataCollectionName) { matchingList.push(triple); } } if (matchingList.length > 1) { // this a error. because there can be only one matching triple alert("Data file error"); } else { // getting other triples for found one var subject = matchingList.shift().subject; var workId, rankWorkId = null; var otherPropTripleList = this._getTriplesBySubject(subject); var workIdProperty = this._getWorkIdProperty(); var rankWorkIdProp = this._getRankingWorkIdProperty(); for (var index=0 ; index < otherPropTripleList.length ; index++) { var triple = otherPropTripleList[index]; var prop = this._getProperty(triple.property); if (workIdProperty == prop) { workId = triple.object; } if (rankWorkIdProp == prop) { rankWorkId = triple.object; } if (workId && rankWorkId) { break; } } var workIdComps = workId.split("/"); var rankWorkIdComps = rankWorkId.split("/"); var subjectComps = subject.split("#"); outObj = { fileName : subjectComps[subjectComps.length-1], workId : workIdComps[workIdComps.length-1], rankListWorkId : rankWorkIdComps[rankWorkIdComps.length-1] }; } return outObj; }, _getProperty : function(propertyUrl) { var comps = propertyUrl.split("#"); return comps[comps.length-1]; }, _getWorkIdProperty : function() { var hostName = window.location.hostname; if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) { return this._properties.workIdInTest; } else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) { return this._properties.workIdPublic; } }, _getRankingWorkIdProperty : function() { var hostName = window.location.hostname; if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) { return this._properties.ranklistWorkIdTest; } else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) { return this._properties.ranklistWorkIdPublic; } }, _getTriplesByProperty : function(propName,currentList) { /* this function first will find the triple with the passed property and then this will take the subject of it and will find other properties of that subject */ var filteredList = []; //var currentList = this._getCurrentUsingList(); for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var prop = this._getProperty(triple.property); if (prop == propName) { filteredList.push(triple); } } return filteredList; }, _getTriplesBySubject : function(subject) { var filteredList = []; var currentList = this._getCurrentUsingList(); for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var triSubject = triple.subject; if (triSubject.trim() == subject.trim()) { filteredList.push(triple); } if (filteredList.length == this._fileProperties.length) { break; } } return filteredList; }, // returns a string array _getDistinctObjectList : function(propName,currentList) { var distinctList = []; for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var prop = triple.property; if (prop && prop.indexOf(propName) != -1) { var objVal = triple.object; if (distinctList.indexOf(objVal) == -1) { distinctList.push(objVal); } } } return distinctList; }, _getCurrentUsingList : function() { if (this._currentFilteredList.length == 0) { return this._fullList; } else { return this._currentFilteredList; } }, } /* Application.baseLineSequence = function() { this._init.apply(this, arguments); }; Application.baseLineSequence.prototype = { _attedSequenceInfo : null, _ppdbSequenceInfo : null, _default : { sequenceProperty : "baseline%20sequence" }, _tag : { attedBaseSequenceTag : "atted_baseLineSequence", ppdbBaseSequenceTag : "ppdb_baseLineSequence" }, _init : function() { this._attedSequenceInfo = {}; this._ppdbSequenceInfo = {}; this._initBaseSequenceFile(); }, _initBaseSequenceFile : function() { this._initAttedBaseSequenceFile(); this._initPpdbBaseSequenceFile(); }, _initAttedBaseSequenceFile : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initAttedInfo(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._tag.attedBaseSequenceTag, getFilesByTag); }, _initPpdbBaseSequenceFile : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initPpdbInfo(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._tag.ppdbBaseSequenceTag, getFilesByTag); }, _initAttedInfo : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { var propOnly = pValue.split("#")[1]; if (propOnly == self._default.sequenceProperty) { self._attedSequenceInfo.workId = workId; self._attedSequenceInfo.fileName = fileName; self._attedSequenceInfo.property = pValue; return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _initPpdbInfo : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { var propOnly = pValue.split("#")[1]; if (propOnly == self._default.sequenceProperty) { self._ppdbSequenceInfo.workId = workId; self._ppdbSequenceInfo.fileName = fileName; self._ppdbSequenceInfo.property = pValue; return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getAttedSubjectUrl : function(gene) { return "http://atted.jp/data/locus/" + gene + ".html"; }, _getPpdbSubjectUrl : function(gene) { return "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene; }, _getAttedBaseSequence : function(gene, callback) { var self = this; var workId = self._attedSequenceInfo.workId; var fileName = self._attedSequenceInfo.fileName; var property = self._attedSequenceInfo.property; var subject = self._getAttedSubjectUrl(gene); var getObjects = function(objList) { callback(objList[0]); } LinkData.getObjects(workId, fileName, subject, property, getObjects); }, _getPpdbBaseSequence : function(gene, callback) { var self = this; var workId = self._ppdbSequenceInfo.workId; var fileName = self._ppdbSequenceInfo.fileName; var property = self._ppdbSequenceInfo.property; var subject = self._getPpdbSubjectUrl(gene); var getObjects = function(objList) { callback(objList[0]); } LinkData.getObjects(workId, fileName, subject, property, getObjects); }, getBaseSequence : function(gene, geneType, callback) { var self = this; if ("ATTED" === geneType) { self._getAttedBaseSequence(gene, callback); } else if ("PPDB" === geneType) { self._getPpdbBaseSequence(gene, callback); } else { // error } } }; */ Application.baseLineSequence = function() { this._init.apply(this,arguments); } Application.baseLineSequence.prototype = { _baseLineSeqFileInfo : null, _default : { sequenceProperty : "promoter%20sequence", linkdataTestUrl : "test.linkdata.org", linkdatapublicUrl : "linkdata.org" }, _tag : { baseSequenceTag : "promoter_sequence", }, _init : function() { this._findBaseLineSequenceFile(); this._baseLineSeqFileInfo = {}; }, _findBaseLineSequenceFile : function() { // looking one tagged file only var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initBaseLineSequenceFileInfo(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._tag.baseSequenceTag, getFilesByTag); }, _initBaseLineSequenceFileInfo : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { var propOnly = pValue.split("#")[1]; if (propOnly == self._default.sequenceProperty) { self._baseLineSeqFileInfo.workId = workId; self._baseLineSeqFileInfo.fileName = fileName; self._baseLineSeqFileInfo.property = pValue; return false; } }); }; LinkData.getProperties(workId, fileName, getProperties); }, _getSubject : function(gene) { var hostName = window.location.hostname; var subject = null; gene = gene.toUpperCase(); if (hostName.indexOf(this._default.linkdataTestUrl) != -1) { subject = this._default.linkdataTestUrl + "/resource/" + this._baseLineSeqFileInfo.workId + "#" + gene; } else if (hostName.indexOf(this._default.linkdatapublicUrl) != -1) { subject = this._default.linkdatapublicUrl + "/resource/" + this._baseLineSeqFileInfo.workId + "#" + gene;; } return "http://" + subject; }, _getBaseSequence : function(gene, callback) { var self = this; var workId = self._baseLineSeqFileInfo.workId; var fileName = self._baseLineSeqFileInfo.fileName; var property = self._baseLineSeqFileInfo.property; var subject = self._getSubject(gene); var getObjects = function(objList) { callback(objList[0]); } LinkData.getObjects(workId, fileName, subject, property, getObjects); } } Application.tooltip = function() { this._init.apply(this, arguments); }; Application.tooltip.prototype = { _toolTipList : null, _default : { explanationProperty : "explanation" }, _init : function() { this._toolTipList = []; this._initToolTip(); }, _initToolTip : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._getFilePropertyList(workId, fileName); }); }); } LinkData.getFilesByTag(null, "tooltip", getFilesByTag); }, _getFilePropertyList : function(workId, fileName) { var self = this; var index = new Application.index(1, 10000); var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.explanationProperty) > -1) { self._getSubjectList(workId, fileName, pValue, index); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getSubjectList : function(workId, fileName, property, index) { var self = this; var getSubjects = function(subjectList) { self._getPropertyList(subjectList, workId, fileName, property, index); } LinkData.getSubjects(workId, fileName, getSubjects, index); }, _getPropertyList : function(subjectList, workId, fileName, property, index) { var self = this; var getTriplesByProperty = function(tripleList) { self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index); } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index); }, _addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) { var self = this; for (var i = 0; i < subjectList.length; i++) { var key = self._getLabelAfterHash(subjectList[i]); if (tripleList[i]) { var value = tripleList[i].object; self._addToolTip(key, value); } } if (subjectList && subjectList.length == index.getItemCount()) { self._getSubjectList(workId, fileName, property, index.increment()); } }, _addToolTip : function(key, tooltip) { var obj = {}; obj.key = key; obj.tooltip = tooltip; this._toolTipList.push(obj); }, getByKey : function(key) { var self = this, tooltip; $.each(self._toolTipList, function(objKey, obj) { if (obj.key.toString().toLowerCase() === key.toString().toLowerCase()) { tooltip = obj.tooltip; return false; } }); return (tooltip) ? tooltip : ""; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.index = function() { this._init.apply(this, arguments); } Application.index.prototype = { _start : null, _end : null, _init : function(start, end) { this._start = start; this._end = end; }, getIndex : function() { return {start : this._start, end : this._end}; }, getItemCount : function() { return (this._end - this._start + 1); }, increment : function() { var itemCount = this.getItemCount(); this._start = this._start + itemCount; this._end = this._end + itemCount; return {start : this._start, end : this._end}; }, getStartIndex : function() { return this._start; }, getEndIndex : function() { return this._end; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 100; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; }, setMaxRetryCount : function(no) { this._maxRetry = no; } }; Application.MotifConflication = function() { this._init.apply(this, arguments); }; $(document).ready(function() { new Application.genocon(); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } #gcAppContainer { width: 900px; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 165px; } input.baseSequence { /*width: 100%;*/ } .highlight-sequence { font-weight: bold; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; white-space: nowrap; } .resultArea .userSequence { white-space: nowrap; float: left; } .finishSequence, .replaceSequenc { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; width: 100%; overflow: auto; white-space: nowrap; } .wrappedSequenceMotif { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; overflow: auto; word-wrap: break-word; white-space: normal; width:100%; height:90px; word-break: break-all; } .replace { color: #E80010; } .baseErrorMessage, .errorMessage { color: black; /*text-align: center;*/ margin-bottom: -10px; margin-top: 10px; } .errorText { color: #FF0000; } .applicationContainer { background-color: #F6F6F6; border: 1px solid #CCCCCC; margin: 5px 0 0; padding: 5px; } .actionButtonContainer { text-align: right; } .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .row { padding: 5px 0; } .row:after { clear: left; content: ""; display: block; } .row input[type="text"] { width: 200px; } .row .externalLink { margin: 0 5px; } .noborder { border: medium none; } #baseSequenceContainer .baseSequenceBox { width: 100%; overflow: auto; white-space: nowrap; } #baseSequenceContainer .baseSequenceBox span, #baseSequenceContainer .baseSequenceBox .baseSequence { font-family: Courier; } #baseSequenceContainer .baseSequenceBox .fixedSequence { position: relative; left: -6px; color: #AAAAAA; font-weight: bold; } .applicationContainer .nextButtonContainer { margin-top: 10px; } .databaseInfo .motif { width: 70%; } /** * button css */ a.useButton { width: 150px; } .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; margin-left: 200px; margin-top : -10px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; } .loadingImageContainer .loadingMessage { color: #FF0000; } .motifConflictionDialog .option { margin: 10px; } .motifViewDialog { margin-top: 10px; } .motifViewDialog .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; width : 200px; } .motifViewDialog .motifviewinfo { float: right; margin-top: -150px; position: relative; width: 350px; } .deletelink { cursor: pointer; } .deletelink img { margin-bottom: -3px; } .manualMotifView .manualMotifViewInfo { float: right; height: 90px; margin-right: 10px; margin-top: -65px; position: relative; width: 380px; } .baseSequenceBox textarea { resize: none; width: 490px; height: 115px; } .fixedSequenceCheckBox { float: right; margin-right: 210px; margin-top: -115px; } .fixedSequenceMsg { float: right; margin-right: 20px; margin-top: -40px; } .fixedSequenceMotif { display: inline; float: right; font-family: "Courier New","Lucida Console"; margin-top: -15px; } .resultAreaUserMessageClass { color: #0A5DA6; font: bold 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; font-size: 12px; font-weight: bold; margin-top: -6px; margin-bottom: 4px; } .finishSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; font-family: "Courier New","Lucida Console"; height: 100px; margin: 10px 0 0; overflow: auto; width: 480px; word-break: break-all; word-wrap: break-word; white-space: normal; } .finishSequenceFixed { display: inline; float: right; font-family: "Courier New","Lucida Console"; margin-top: -15px; } .manualsequence { float: right; height: 40px; overflow: auto; width: 300px; margin-bottom: 5px; } .motifviewsequence { float: right; height: 40px; margin-bottom: 5px; overflow: auto; width: 240px; }
<div id="gcAppContainer"> <div id="baseSequenceContainer"> <div class="label baseSequenceLabel">Base Sequence</div> <div class="baseSequenceBox"> <span> <textarea type="text" cols=45 rows=5 class="baseSequence" value="" disabled=true maxlength=500> </textarea> </span> <span class="fixedSequence">GATCCCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG</span> </div> <div> <div class="fixedSequenceCheckBox"><input type="checkbox" id="chkEmptySequnce" value="true" checked=true>Start with empty sequence</div> <div class="fixedSequenceMsg">Minimal Promoter (fixed)</div> </div> <div style="margin-top:5px;"><a class="useButton btn btn-green">Start promoter design</a></div> <div class="baseErrorMessage hidden"></div> </div> <div class="applicationContainer hidden"> <div class="actionButtonContainer"> <span class="appSummery"></span> <span class="collapseButton actionBtn" title="collapse">_</span> <span class="expandButton actionBtn" title="expand">+</span> <span class="removeButton actionBtn" title="remove">x</span> <br clear="all"/> </div> <div class="applicationDataContainer"> <div class="row"> <div class="label left optionListLabel">Select Tool</div> <div class="left"> <select class="optionList"></select> <!-- <span class="applicationOptionRadio hidden"> <input type="radio" name="applicationOption" value="max" checked="checked"/> Max <input type="radio" name="applicationOption" value="min"/> Min </span> --> </div> </div> <div class="row hidden analysisMethodContainer"> <div class="label left analysisMethodLabel">Analysis Method</div> <div class="left"> <select class="analysisMethod"></select> </div> </div> <div class="row hidden expressionDbContainer"> <div class="label left expressionDbLabel">Expression DataBase</div> <div class="left"> <select class="expressionDb"></select> </div> </div> <div class="row hidden dataColContainer"> <div class="label left dataColLabel">Data Collection</div> <div class="left"> <select class="dataCol"></select> </div> </div> <div class="actionResultContainer"></div> <div class="nextButtonContainer hidden"> <a class="btn nextButton">Next</a> <a class="btn repeatAgain">Repeat settings</a> <a class="btn finishNow">Finish Now</a> </div> <div class="finishSequenceContainer hidden"> <div class="finishSequence"></div> <div class="finishSequenceFixed"></div> </div> </div> </div> </div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
Circadian Coexpression (DIURNAL + ATTED-II promoter motif)
Contributor:Koro_Nishikata
Update:Mar 7, 2013
5129 Downloads, 14 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the CEG motifs as calculated by ATTED-II. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_COL_LDHH.html#work_information'>DiurnalHours_ATTED_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_COL_SD.html#work_information'>DiurnalHours_ATTED_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_DD_DDHC.html#work_information'>DiurnalHours_ATTED_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LDHC.html#work_information'>DiurnalHours_ATTED_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LDHH_SM.html#work_information'>DiurnalHours_ATTED_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LDHH_ST.html#work_information'>DiurnalHours_ATTED_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LER_SD.html#work_information'>DiurnalHours_ATTED_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LIGHT5_znknOX.html#work_information'>DiurnalHours_ATTED_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LL12_LDHH.html#work_information'>DiurnalHours_ATTED_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LL23_LDHH.html#work_information'>DiurnalHours_ATTED_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LLHC.html#work_information'>DiurnalHours_ATTED_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LL_LDHC.html#work_information'>DiurnalHours_ATTED_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_LL_LLHC.html#work_information'>DiurnalHours_ATTED_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_lhyox_SD.html#work_information'>DiurnalHours_ATTED_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_longday.html#work_information'>DiurnalHours_ATTED_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_lux_2_LDHH.html#work_information'>DiurnalHours_ATTED_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_phyB9_SD.html#work_information'>DiurnalHours_ATTED_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s586i/DiurnalHours_ATTED_shortday.html#work_information'>DiurnalHours_ATTED_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_ATTED_COL_LDHH
DiurnalHours_ATTED_COL_SD
DiurnalHours_ATTED_DD_DDHC
DiurnalHours_ATTED_LDHC
DiurnalHours_ATTED_LDHH_SM
DiurnalHours_ATTED_LDHH_ST
DiurnalHours_ATTED_LER_SD
DiurnalHours_ATTED_LIGHT5_HIF138_13
DiurnalHours_ATTED_LIGHT5_HIF138_8
DiurnalHours_ATTED_LIGHT5_znknOX
DiurnalHours_ATTED_LL12_LDHH
DiurnalHours_ATTED_LL23_LDHH
DiurnalHours_ATTED_LLHC
DiurnalHours_ATTED_LL_LDHC
DiurnalHours_ATTED_LL_LLHC
DiurnalHours_ATTED_lhyox_SD
DiurnalHours_ATTED_longday
DiurnalHours_ATTED_lux_2_LDHH
DiurnalHours_ATTED_phyB9_SD
DiurnalHours_ATTED_shortday
Rank Lists of AtGenExpress ATTED normalize
Contributor:Koro_Nishikata
Update:Mar 6, 2013
373 Downloads, 10 Applications
Lists for the normalized expression of AtGenExpress and ATTED-II mashup data table. For each experiment, all genes ranked by normalized expression level. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s715i/AtGenExpress_ATTED_normalize_all.html#work_information'>AtGenExpress_ATTED_normalize_all</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the all genes ranked by normalized expression level. </td> </tr> </table>
AtGenExpress_ATTED_normalize_all
[
motifexpress
]
Circadian Genomic (DIURNAL + PPDB promoter motif) normalized
Contributor:Koro_Nishikata
Update:May 10, 2013
4943 Downloads, 10 Applications
Normalized Expression Data of DIURNAL circadian conditions, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_COL_LDHH_normalize.html#work_information'>DiurnalHours_PPDB_COL_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_COL_SD_normalize.html#work_information'>DiurnalHours_PPDB_COL_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_DD_DDHC_normalize.html#work_information'>DiurnalHours_PPDB_DD_DDHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LDHC_normalize.html#work_information'>DiurnalHours_PPDB_LDHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LDHH_SM_normalize.html#work_information'>DiurnalHours_PPDB_LDHH_SM_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LDHH_ST_normalize.html#work_information'>DiurnalHours_PPDB_LDHH_ST_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LER_SD_normalize.html#work_information'>DiurnalHours_PPDB_LER_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LIGHT5_HIF138_13_normalize.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_13_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LIGHT5_HIF138_8_normalize.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_8_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LIGHT5_znknOX_normalize.html#work_information'>DiurnalHours_PPDB_LIGHT5_znknOX_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LL12_LDHH_normalize.html#work_information'>DiurnalHours_PPDB_LL12_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LL23_LDHH_normalize.html#work_information'>DiurnalHours_PPDB_LL23_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LLHC_normalize.html#work_information'>DiurnalHours_PPDB_LLHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LL_LDHC_normalize.html#work_information'>DiurnalHours_PPDB_LL_LDHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_LL_LLHC_normalize.html#work_information'>DiurnalHours_PPDB_LL_LLHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_lhyox_SD_normalize.html#work_information'>DiurnalHours_PPDB_lhyox_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_longday_normalize.html#work_information'>DiurnalHours_PPDB_longday_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_lux_2_LDHH_normalize.html#work_information'>DiurnalHours_PPDB_lux_2_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_phyB9_SD_normalize.html#work_information'>DiurnalHours_PPDB_phyB9_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s708i/DiurnalHours_PPDB_shortday_normalize.html#work_information'>DiurnalHours_PPDB_shortday_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
DiurnalHours_PPDB_COL_LDHH_normalize
DiurnalHours_PPDB_COL_SD_normalize
DiurnalHours_PPDB_DD_DDHC_normalize
DiurnalHours_PPDB_LDHC_normalize
DiurnalHours_PPDB_LDHH_SM_normalize
DiurnalHours_PPDB_LDHH_ST_normalize
DiurnalHours_PPDB_LER_SD_normalize
DiurnalHours_PPDB_LIGHT5_HIF138_13_normalize
DiurnalHours_PPDB_LIGHT5_HIF138_8_normalize
DiurnalHours_PPDB_LIGHT5_znknOX_normalize
DiurnalHours_PPDB_LL12_LDHH_normalize
DiurnalHours_PPDB_LL23_LDHH_normalize
DiurnalHours_PPDB_LLHC_normalize
DiurnalHours_PPDB_LL_LDHC_normalize
DiurnalHours_PPDB_LL_LLHC_normalize
DiurnalHours_PPDB_lhyox_SD_normalize
DiurnalHours_PPDB_longday_normalize
DiurnalHours_PPDB_lux_2_LDHH_normalize
DiurnalHours_PPDB_phyB9_SD_normalize
DiurnalHours_PPDB_shortday_normalize
Rank Lists of AtGenExpress PPDB normalize
Contributor:Koro_Nishikata
Update:Apr 25, 2013
395 Downloads, 10 Applications
Lists for the normalized expression of AtGenExpress and PPDB mashup data table. For each experiment, all genes ranked by normalized expression level. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s717i/AtGenExpress_PPDB_normalize_all.html#work_information'>AtGenExpress_PPDB_normalize_all</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by normalized expression level. </td> </tr> </table>
AtGenExpress_PPDB_normalize_all
[
motifexpress
]
Circadian Coexpression (DIURNAL + ATTED-II promoter motif) normalized
Contributor:Koro_Nishikata
Update:Mar 7, 2013
4183 Downloads, 10 Applications
Normalized Expression Data of DIURNAL circadian conditions, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_COL_LDHH_normalize.html#work_information'>DiurnalHours_ATTED_COL_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_COL_SD_normalize.html#work_information'>DiurnalHours_ATTED_COL_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_DD_DDHC_normalize.html#work_information'>DiurnalHours_ATTED_DD_DDHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LDHC_normalize.html#work_information'>DiurnalHours_ATTED_LDHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LDHH_SM_normalize.html#work_information'>DiurnalHours_ATTED_LDHH_SM_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LDHH_ST_normalize.html#work_information'>DiurnalHours_ATTED_LDHH_ST_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LER_SD_normalize.html#work_information'>DiurnalHours_ATTED_LER_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LIGHT5_HIF138_13_normalize.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_13_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LIGHT5_HIF138_8_normalize.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_8_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LIGHT5_znknOX_normalize.html#work_information'>DiurnalHours_ATTED_LIGHT5_znknOX_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LL12_LDHH_normalize.html#work_information'>DiurnalHours_ATTED_LL12_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LL23_LDHH_normalize.html#work_information'>DiurnalHours_ATTED_LL23_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LLHC_normalize.html#work_information'>DiurnalHours_ATTED_LLHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LL_LDHC_normalize.html#work_information'>DiurnalHours_ATTED_LL_LDHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_LL_LLHC_normalize.html#work_information'>DiurnalHours_ATTED_LL_LLHC_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_lhyox_SD_normalize.html#work_information'>DiurnalHours_ATTED_lhyox_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_longday_normalize.html#work_information'>DiurnalHours_ATTED_longday_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_lux_2_LDHH_normalize.html#work_information'>DiurnalHours_ATTED_lux_2_LDHH_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_phyB9_SD_normalize.html#work_information'>DiurnalHours_ATTED_phyB9_SD_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s587i/DiurnalHours_ATTED_shortday_normalize.html#work_information'>DiurnalHours_ATTED_shortday_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_ATTED_COL_LDHH_normalize
DiurnalHours_ATTED_COL_SD_normalize
DiurnalHours_ATTED_DD_DDHC_normalize
DiurnalHours_ATTED_LDHC_normalize
DiurnalHours_ATTED_LDHH_SM_normalize
DiurnalHours_ATTED_LDHH_ST_normalize
DiurnalHours_ATTED_LER_SD_normalize
DiurnalHours_ATTED_LIGHT5_HIF138_13_normalize
DiurnalHours_ATTED_LIGHT5_HIF138_8_normalize
DiurnalHours_ATTED_LIGHT5_znknOX_normalize
DiurnalHours_ATTED_LL12_LDHH_normalize
DiurnalHours_ATTED_LL23_LDHH_normalize
DiurnalHours_ATTED_LLHC_normalize
DiurnalHours_ATTED_LL_LDHC_normalize
DiurnalHours_ATTED_LL_LLHC_normalize
DiurnalHours_ATTED_lhyox_SD_normalize
DiurnalHours_ATTED_longday_normalize
DiurnalHours_ATTED_lux_2_LDHH_normalize
DiurnalHours_ATTED_phyB9_SD_normalize
DiurnalHours_ATTED_recalculation_COL_SD_normalize
DiurnalHours_ATTED_shortday_normalize
PromoterCAD Data Tables
Contributor:Koro_Nishikata
Update:Apr 26, 2013
404 Downloads, 6 Applications
This will allow the PromoterCAD Application to find the appropriate tools, the input data and the gene rank list.
PromoterCAD_Data_Tables
[
menu
]
Rank Lists of Diurnal PPDB
Contributor:Koro_Nishikata
Update:May 10, 2013
906 Downloads, 14 Applications
Lists for the expression of Diurnal and PPDB mashup data table. For each experiment, all genes ranked by circadian amplitude. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s713i/DiurnalHours_PPDB_all.html#work_information'>DiurnalHours PPDB all</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the all genes ranked by expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s713i/DiurnalHours_PPDB_GeneRank_for_MotifCircadian_all.html#work_information'>DiurnalHours PPDB GeneRank for MotifCircadian all</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
DiurnalHours_PPDB_GeneRank_for_MotifCircadian_all
[
motifcircadian
]
DiurnalHours_PPDB_all
[
motifexpress
]
Rank Lists of AtGenExpress PPDB
Contributor:Koro_Nishikata
Update:May 10, 2013
411 Downloads, 16 Applications
Lists for the expression of AtGenExpress and PPDB mashup data table. For each experiment, all genes ranked by expression level. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s712i/AtGenExpress_PPDB_all.html#work_information'>AtGenExpress_PPDB_all</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by expression level. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
AtGenExpress_PPDB_all
[
motifexpress
]
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) normalized
Contributor:Koro_Nishikata
Update:Apr 22, 2013
2241 Downloads, 10 Applications
Normalized Expression Data of AtGenExpress plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s585i/AtGenExpress_ATTED_Flowering_normalize.html#work_information'>AtGenExpress_ATTED_Flowering_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s585i/AtGenExpress_ATTED_Fruit_Seeds_normalize.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s585i/AtGenExpress_ATTED_Leaf_normalize.html#work_information'>AtGenExpress_ATTED_Leaf_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s585i/AtGenExpress_ATTED_Root_normalize.html#work_information'>AtGenExpress_ATTED_Root_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s585i/AtGenExpress_ATTED_Seedling_normalize.html#work_information'>AtGenExpress_ATTED_Seedling_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s585i/AtGenExpress_ATTED_Stem_normalize.html#work_information'>AtGenExpress_ATTED_Stem_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s585i/AtGenExpress_ATTED_Whole_Plant_normalize.html#work_information'>AtGenExpress_ATTED_Whole_Plant_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> </table>
AtGenExpress_ATTED_Flowering_normalize
AtGenExpress_ATTED_Fruit_Seeds_normalize
AtGenExpress_ATTED_Leaf_normalize
AtGenExpress_ATTED_Root_normalize
AtGenExpress_ATTED_Seedling_normalize
AtGenExpress_ATTED_Stem_normalize
AtGenExpress_ATTED_Whole_Plant_normalize
Rank Lists of Diurnal ATTED
Contributor:Koro_Nishikata
Update:Mar 7, 2013
696 Downloads, 14 Applications
Lists for the expression of Diurnal and ATTED-II mashup data table. For each experiment, all genes ranked by circadian amplitude. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s710i/DiurnalHours_ATTED_all.html#work_information'>DiurnalHours ATTED all</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the all genes ranked by expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s710i/DiurnalHours_ATTED_GeneRank_for_MotifCircadian_all.html#work_information'>DiurnalHours ATTED GeneRank for MotifCircadian all</a> </td> <td> Lists for the DIURNAL and ATTED-II (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table>
DiurnalHours_ATTED_GeneRank_for_MotifCircadian_all
[
motifcircadian
]
DiurnalHours_ATTED_all
[
motifexpress
]
Developmental Coexpression (AtGenExpress gene expression + ATTED-II promoter motif) median
Contributor:Koro_Nishikata
Update:May 1, 2013
2925 Downloads, 16 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Flowering_median.html#work_information'>AtGenExpress_ATTED_Flowering_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Fruit_Seeds_median.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Leaf_median.html#work_information'>AtGenExpress_ATTED_Leaf_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Root_median.html#work_information'>AtGenExpress_ATTED_Root_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Seedling_median.html#work_information'>AtGenExpress_ATTED_Seedling_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Stem_median.html#work_information'>AtGenExpress_ATTED_Stem_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Whole_Plant_median.html#work_information'>AtGenExpress_ATTED_Whole_Plant_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> </table> . </td> </tr> </table>
AtGenExpress_ATTED_Flowering_median
[
]
AtGenExpress_ATTED_Fruit_Seeds_median
[
]
AtGenExpress_ATTED_Leaf_median
[
]
AtGenExpress_ATTED_Root_median
[
]
AtGenExpress_ATTED_Seedling_median
[
]
AtGenExpress_ATTED_Stem_median
[
]
AtGenExpress_ATTED_Whole_Plant_median
[
]
Heptamer_elements
[
heptamer
]
PromoterCAD plugin tools
Contributor:GenoCon
Update:Mar 9, 2013
299 Downloads, 4 Applications
This file is used to register new plugin tools for use in forked versions of PromoterCAD.
PromoterCAD_plugins
[
method
]
Rank Lists of AtGenExpress ATTED
Contributor:Koro_Nishikata
Update:Apr 22, 2013
429 Downloads, 16 Applications
Lists for the expression of AtGenExpress and ATTED-II mashup data table. For each experiment, all genes ranked by expression level. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s709i/AtGenExpress_ATTED_all.html#work_information'>AtGenExpress_ATTED_all</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the all genes ranked by expression level. </td> </tr> </table>
AtGenExpress_ATTED_all
[
motifexpress
]
Developmental Genomic (AtGenExpress + PPDB promoter motif) normalized
Contributor:Koro_Nishikata
Update:May 10, 2013
2221 Downloads, 10 Applications
Normalized Expression Data of AtGenExpress plant developmental tissues, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). <br> <br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s707i/AtGenExpress_PPDB_Flowering_normalize.html#work_information'>AtGenExpress_PPDB_Flowering_normalize</a> </td> <td> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s707i/AtGenExpress_PPDB_Fruit_Seeds_normalize.html#work_information'>AtGenExpress_PPDB_Fruit_Seeds_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s707i/AtGenExpress_PPDB_Leaf_normalize.html#work_information'>AtGenExpress_PPDB_Leaf_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s707i/AtGenExpress_PPDB_Root_normalize.html#work_information'>AtGenExpress_PPDB_Root_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s707i/AtGenExpress_PPDB_Seedling_normalize.html#work_information'>AtGenExpress_PPDB_Seedling_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s707i/AtGenExpress_PPDB_Stem_normalize.html#work_information'>AtGenExpress_PPDB_Stem_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s707i/AtGenExpress_PPDB_Whole_Plant_normalize.html#work_information'>AtGenExpress_PPDB_Whole_Plant_normalize</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
AtGenExpress_PPDB_Flowering_normalize
AtGenExpress_PPDB_Fruit_Seeds_normalize
AtGenExpress_PPDB_Leaf_normalize
AtGenExpress_PPDB_Root_normalize
AtGenExpress_PPDB_Seedling_normalize
AtGenExpress_PPDB_Stem_normalize
AtGenExpress_PPDB_Whole_Plant_normalize
PromoterCAD Beginning Tutorial 1 - Tooltip Information
Contributor:Koro_Nishikata
Update:Apr 30, 2013
973 Downloads, 4 Applications
tooltip_AtGenExpress
[
tooltip
]
tooltip_DataTable
[
tooltip
]
tooltip_PromoterCAD_menus_buttons
[
tooltip
]
Developmental Genomic (AtGenExpress + PPDB promoter motif) median
Contributor:Koro_Nishikata
Update:May 10, 2013
2771 Downloads, 16 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). For each motif, we calculated the position relative to the TSS as determined experimentally (PPDB). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Flowering_median.html#work_information'>AtGenExpress_PPDB_Flowering_median</a> </td> <td> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Fruit_Seeds_median.html#work_information'>AtGenExpress_PPDB_Fruit_Seeds_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Leaf_median.html#work_information'>AtGenExpress_PPDB_Leaf_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Root_median.html#work_information'>AtGenExpress_PPDB_Root_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Seedling_median.html#work_information'>AtGenExpress_PPDB_Seedling_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Stem_median.html#work_information'>AtGenExpress_PPDB_Stem_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Whole_Plant_median.html#work_information'>AtGenExpress_PPDB_Whole_Plant_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/Octamer_elements.html#work_information'>Octamer_elements</a> </td> <td> A list of the 8mer sequence motifs from PPDB. This table lists each 8mer along with the appropriate median position from the TSS, calculated from all 8mers. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
AtGenExpress_PPDB_Flowering_median
[
]
AtGenExpress_PPDB_Fruit_Seeds_median
[
]
AtGenExpress_PPDB_Leaf_median
[
]
AtGenExpress_PPDB_Root_median
[
]
AtGenExpress_PPDB_Seedling_median
[
]
AtGenExpress_PPDB_Stem_median
[
]
AtGenExpress_PPDB_Whole_Plant_median
[
]
Octamer_elements
[
octamer
]
Rank Lists of Diurnal ATTED normalize
Contributor:Koro_Nishikata
Update:Mar 7, 2013
752 Downloads, 10 Applications
Lists for the normalized expression of Diurnal and ATTED-II mashup data table. For each experiment, all genes ranked by normalized circadian amplitude. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s716i/DiurnalHours_ATTED_normalize_all.html#work_information'>DiurnalHours ATTED normalize all</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the all genes ranked by normalized expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s716i/DiurnalHours_ATTED_normalize_GeneRank_for_MotifCircadian_all.html#work_information'>DiurnalHours ATTED normalize GeneRank for MotifCircadian all</a> </td> <td> Lists for the DIURNAL and ATTED-II (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table>
DiurnalHours_ATTED_normalize_GeneRank_for_MotifCircadian_all
[
motifcircadian
]
DiurnalHours_ATTED_normalize_all
[
motifexpress
]
PromoterCAD_links
Contributor:GenoCon
Update:May 16, 2013
303 Downloads, 16 Applications
This will tell the PromoteCAD Application the external link URL of each gene locus.
External_Links
[
external_links
]
Circadian Genomic (DIURNAL + PPDB promoter motif)
Contributor:Koro_Nishikata
Update:May 10, 2013
4717 Downloads, 14 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the LDSS motifs as calculated by PPDB. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_COL_LDHH.html#work_information'>DiurnalHours_PPDB_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_COL_SD.html#work_information'>DiurnalHours_PPDB_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_DD_DDHC.html#work_information'>DiurnalHours_PPDB_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LDHC.html#work_information'>DiurnalHours_PPDB_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LDHH_SM.html#work_information'>DiurnalHours_PPDB_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LDHH_ST.html#work_information'>DiurnalHours_PPDB_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LER_SD.html#work_information'>DiurnalHours_PPDB_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LIGHT5_znknOX.html#work_information'>DiurnalHours_PPDB_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LL12_LDHH.html#work_information'>DiurnalHours_PPDB_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LL23_LDHH.html#work_information'>DiurnalHours_PPDB_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LLHC.html#work_information'>DiurnalHours_PPDB_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LL_LDHC.html#work_information'>DiurnalHours_PPDB_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_LL_LLHC.html#work_information'>DiurnalHours_PPDB_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_lhyox_SD.html#work_information'>DiurnalHours_PPDB_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_longday.html#work_information'>DiurnalHours_PPDB_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_lux_2_LDHH.html#work_information'>DiurnalHours_PPDB_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_phyB9_SD.html#work_information'>DiurnalHours_PPDB_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s706i/DiurnalHours_PPDB_shortday.html#work_information'>DiurnalHours_PPDB_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
DiurnalHours_PPDB_COL_LDHH
DiurnalHours_PPDB_COL_SD
DiurnalHours_PPDB_DD_DDHC
DiurnalHours_PPDB_LDHC
DiurnalHours_PPDB_LDHH_SM
DiurnalHours_PPDB_LDHH_ST
DiurnalHours_PPDB_LER_SD
DiurnalHours_PPDB_LIGHT5_HIF138_13
DiurnalHours_PPDB_LIGHT5_HIF138_8
DiurnalHours_PPDB_LIGHT5_znknOX
DiurnalHours_PPDB_LL12_LDHH
DiurnalHours_PPDB_LL23_LDHH
DiurnalHours_PPDB_LLHC
DiurnalHours_PPDB_LL_LDHC
DiurnalHours_PPDB_LL_LLHC
DiurnalHours_PPDB_lhyox_SD
DiurnalHours_PPDB_longday
DiurnalHours_PPDB_lux_2_LDHH
DiurnalHours_PPDB_phyB9_SD
DiurnalHours_PPDB_shortday
Rank Lists of Diurnal PPDB normalize
Contributor:Koro_Nishikata
Update:May 10, 2013
846 Downloads, 10 Applications
Lists for the normalized expression of Diurnal and PPDB mashup data table. For each experiment, all genes ranked by normalized circadian amplitude. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s718i/DiurnalHours_PPDB_normalize_all.html#work_information'>DiurnalHours PPDB normalize all</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the all genes ranked by normalized expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s718i/DiurnalHours_PPDB_normalize_GeneRank_for_MotifCircadian_all.html#work_information'>DiurnalHours PPDB normalize GeneRank for MotifCircadian all</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
DiurnalHours_PPDB_normalize_GeneRank_for_MotifCircadian_all
[
motifcircadian
]
DiurnalHours_PPDB_normalize_all
[
motifexpress
]
Arabidopsis promoter sequence
Contributor:Koro_Nishikata
Update:Sep 3, 2013
279 Downloads, 10 Applications
<p> Baseline promoter sequences from <i>Arabidopsis</i>, calculated based on the PPDB data and TAIR9 information. </p>
arabidopsis_promoter_sequence
[
promoter_sequence
]
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s326i?tab=readme
Initial content
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
Work
Add
Clear
insert work id or work name.