Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
Interactive Tutorial PromoterCAD for MotifRanking
useful
0
Loading...
if (typeof Application == "undefined" || !Application) { var Application = {}; } Application.genocon = function() { this._init.apply(this, arguments); }; Application.genocon.prototype = { CHAR_SEQ_EMPTY : "-", _baseSequence : null, _tooltip : null, _methodList : null, _appBaseLineSequence : null, _appMenuHandler : null, _default : { baseSequenceContainerId : "baseSequenceContainer", fixedSequenceClass : "fixedSequence", finishSequence : "finishSequence", baseErrorMessageClass : "baseErrorMessage", errorMessageEnterSequence : "Please enter a sequence of minimum length {0}", errorMessageMaximumSequence : "Please enter a sequence of maximum length {0}", useButtonClass : "useButton", nextButtonClass : "nextButton", finishNowButtonClass : "finishNow", nextButtonContainerClass : "nextButtonContainer", collapseButton : "collapseButton", expandButton : "expandButton", removeButton : "removeButton", appContainerClass : "applicationContainer", appDataContainerClass : "applicationDataContainer", actionButtonContainer : "actionButtonContainer", actionResultContainer : "actionResultContainer", baseSequenceBoxClass : "baseSequenceBox", baseSequenceClass : "baseSequence", selectDataBaseList : "databaseList", selectMethodList : "optionList", databaseFilteringProperty : "#motif%20sequence", methodUrlProperty : "#application%20URL", baseSequenceMinLength : 50, baseSequenceMaxLength : 500, applicationOptionClass : "applicationOptionRadio", analysisMethodComboClass : "analysisMethod", expressionDbComboClass : "expressionDb", dataColomboClass : "dataCol", analysisMethodContainer : "analysisMethodContainer", expressionDbContainer : "expressionDbContainer", dataColContainer : "dataColContainer", chkEmptySequenceId : "chkEmptySequnce", analysisMethodComboEmptyOptionText : "-- Select Analysis Method --", expressionDbComboEmptyOptionText : "-- Select Expression Database --", dataColColomboEmptyOptionText : "-- Select Data Collection --", manualMotifEntryToolName : "InputMotif", itemLabelPostfix : "Label", finishSequenceFixedClass : "finishSequenceFixed" }, _tag : { databaseTag : "database", methodTag : "method" }, _tooltipName : { atGeneExpress : "atgenexpress", diurnal : "diurnal", selectDatabase : "selectdatabase", selectTool : "Select Tool", motifExpress : "motifexpress", motifCircatian : "motifcircadian", motifRank : "motifrank", motifQuery : "motifquery", inputMotif : "inputmotif", defaultSequence : "Base Sequence", fixedSequence : "gacccttcctctatataaggaagttcatttcatttggagaggacctcgac", finishNow : "Finish Now", next : "Next", expressionDb : "Expression Database", analysisMethod : "Analysis Method", dataCollection : "Data Collection", baseSequence : "Base Sequence", finishNow : "Finish Now", startButton : "Start" // 追加 //expressionRanking: "Expression Ranking", }, _init : function() { this._methodList = []; this._initToolTip(); this._initDefaultSequence(); this._initAppBaseLineSequence(); this._initLoadScript(); this._initUseButtonListener(); this._initAppMenuHanndler(); this._initAnalysisMethodListener(); this._initExpressionDbListener(); this._initDataCollectionListener(); this._initEmptySequenceCheckBox(); }, _initToolTip : function() { this._tooltip = new Application.tooltip(); }, _initEmptySequenceCheckBox : function() { var self = this; $("#" + this._default.chkEmptySequenceId).click(function() { if ($(this).is(":checked")) { var textArea = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass) $(textArea).attr("value",""); self._fillEmptyBaseSequence(); $(textArea).attr("disabled",true); } else { $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",false); } }); /* following two lines were added to correct the behaviour, if user just pressed F5 button to refresh the browser. in that case if previously checkbox is unnchecked, even after pressing F5, it remains unchecked in the new window */ $("#" + this._default.chkEmptySequenceId).attr("checked","checked"); $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("disabled",true); }, _initDefaultSequence : function() { var self = this; this._fillEmptyBaseSequence(); /*for (var i = 0; i < self._default.baseSequenceMaxLength; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } $baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass); $baseInput.val(sb.join(""));*/ $baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass); $baseInput.attr("value",$baseInput.val()); $baseInput.keyup(function() { //var size = ($baseInput.val().length != 0) ? $baseInput.val().length : 1; //$baseInput.attr("size", size); $baseInput.attr("value", $baseInput.val()); }); $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceBoxClass).scrollLeft(10000); var timer = new Application.timer(); var applyToolTip = function() { var dToolTip = self._getToolTip(self._tooltipName.defaultSequence); var fToolTip = self._getToolTip(self._tooltipName.fixedSequence); var toolToolTip = self._getToolTip(self._tooltipName.selectTool); var analysisCmbToolTip = self._getToolTip(self._tooltipName.analysisMethod); var expDbToolTip = self._getToolTip(self._tooltipName.expressionDb); var dataCollToolTip = self._getToolTip(self._tooltipName.dataCollection); var startButToolTip = self._getToolTip(self._tooltipName.startButton); if (dToolTip && fToolTip) { var labelPostfix = self._default.itemLabelPostfix; $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("title", dToolTip); $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass + labelPostfix).attr("title", dToolTip); $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).attr("title", fToolTip); $("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass).attr("title", analysisCmbToolTip); $("." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass + labelPostfix).attr("title", analysisCmbToolTip); $("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass).attr("title", expDbToolTip); $("." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass + labelPostfix).attr("title", expDbToolTip); $("." + self._default.appContainerClass + " ." + self._default.dataColomboClass).attr("title", dataCollToolTip); $("." + self._default.appContainerClass + " ." + self._default.dataColomboClass + labelPostfix).attr("title", dataCollToolTip); $("." + self._default.appContainerClass + " ." + self._default.selectMethodList).attr("title", toolToolTip); $("." + self._default.appContainerClass + " ." + self._default.selectMethodList + labelPostfix).attr("title", toolToolTip); $(" ." + self._default.useButtonClass).attr("title", startButToolTip); } else { timer.call(applyToolTip); } } applyToolTip(); }, _initAppBaseLineSequence : function() { this._appBaseLineSequence = new Application.baseLineSequence(); }, _initAppMenuHanndler : function() { this._appMenuHandler = new Application.MenuHandler() }, _initLoadScript : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var getProperties = function(propertytList) { $.each(propertytList, function(propKey, propVal) { if (propVal.indexOf(self._default.methodUrlProperty) > -1) { self._loadPluginScriptList(workId, fileName, propVal); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); return false; }); }); } LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag); }, _initDefaultContainer : function() { //this._initDatabase(); this._initMethod(); this._initActionButton(); //this._initDatabaseListener(); this._initMethodListener(); }, /* _initDatabase : function() { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList); $select.attr("title", self._getToolTip(self._tooltipName.selectDatabase)); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Database --</option>"); var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var dbKey = self._getDatabaseOptionKey(workId, fileName); var tooltip = self._tooltip.getByKey(fileName); $select.append("<option value='" + dbKey + "' title='" + tooltip + "'>" + fileName + "</option>"); }); }); } LinkData.getFilesByTag("", self._tag.databaseTag, getFilesByTag); },*/ _initMethod : function() { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Tool --</option>"); $select.attr("title", self._getToolTip(self._tooltipName.selectTool)); var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var getSubjects = function(subjectList) { $.each(subjectList, function(subKey, subVal) { var label = self._getLabel(subVal); var tooltip = self._getToolTipByToolName(label); tooltip = (tooltip) ? tooltip : ""; $select.append("<option value='" + label + "' title='" + tooltip + "'>" + label + "</option>"); self._methodList.push(label); }); } LinkData.getSubjects(workId, fileName, getSubjects); }); }); } LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag); }, _initActionButton : function() { var self = this; $("." + self._default.actionButtonContainer + " ." + self._default.collapseButton).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.appDataContainerClass).hide(); }); $("." + self._default.actionButtonContainer + " ." + self._default.expandButton).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.appDataContainerClass).show(); }); $("." + self._default.actionButtonContainer + " ." + self._default.removeButton).click(function() { if ($("." + self._default.appContainerClass).length == 1) { $("." + self._default.appContainerClass).hide(); $("." + self._default.appContainerClass + " .actionResultContainer").html(""); //$("." + self._default.appContainerClass + " .databaseList").find.empty(); //$("." + self._default.appContainerClass + " .optionList").find('option').remove(); $("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).show(); } else { $(this).closest("." + self._default.appContainerClass).remove(); } }); }, /* _initDatabaseListener : function() { var self = this; var $selectDb = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList); $selectDb.change(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.applicationOptionClass).hide(); $(parent).find("." + self._default.selectMethodList + " option").removeAttr("selected"); $(parent).find("." + self._default.nextButtonContainerClass).hide(); $container = $(parent).find("." + self._default.actionResultContainer); $container.html(""); var dbKey = $("option:selected", $(this)).val(); self._changeMethodList(dbKey); }); },*/ // tool listner _initMethodListener : function() { var self = this; //var $selectDb = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList); var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $select.change(function() { var selectedTool = $(this).val(); if (selectedTool != "-1") { var parent = $(this).closest("." + self._default.appContainerClass); if (selectedTool == self._default.manualMotifEntryToolName) { $(parent).find("." + self._default.applicationOptionClass).hide(); self._showSelectedPlugin(null,$(this)); } else { //self._clearWorkingArea(this); self._initMotifExpressOptions(this); self._fillAnalysisMethodCombo(this); $(parent).find("." + self._default.analysisMethodContainer).show(); } self._resetDataMiningCombos(this); //var comboId = "." + self._default.appContainerClass + " ." + self._default.selectMethodList; //self._makeTheDomChangeOfComboSelect(comboId,selectedTool); } }); }, _makeTheDomChangeOfComboSelect : function(comboSelecter, value) { $(comboSelecter + " option").each(function(i){ var optionVal = $(this).val(); if (optionVal == value) { $(this).attr("selected",true); } }); }, _initAnalysisMethodListener : function() { var self = this; var selecter = "." + self._default.appContainerClass + " ." + self._default.analysisMethodComboClass; var $select = $(selecter); $select.change(function() { var selectedAnalysisMethod = $(this).val(); if (selectedAnalysisMethod != "-1") { var parent = $(this).closest("." + self._default.appContainerClass); self._fillExpressionDBCombo(this); self._resetDataMiningCombos(this); $(parent).find("." + self._default.expressionDbContainer).show(); //self._makeTheDomChangeOfComboSelect(selecter, selectedAnalysisMethod); } }); }, _initExpressionDbListener : function() { var self = this; var selector = "." + self._default.appContainerClass + " ." + self._default.expressionDbComboClass var $select = $(selector); $select.change(function() { var selectedExpressionDb = $(this).val(); if (selectedExpressionDb != "-1") { var parent = $(this).closest("." + self._default.appContainerClass); self._fillDataCollectionCombo(this); self._resetDataMiningCombos(this); $(parent).find("." + self._default.dataColContainer).show(); //self._makeTheDomChangeOfComboSelect(selector, selectedExpressionDb); } }); }, _initDataCollectionListener : function() { var self = this; var selector = "." + self._default.appContainerClass + " ." + self._default.dataColomboClass; var $select = $(selector); $select.change(function() { var selectedDataCollection = $(this).val(); if (selectedDataCollection != "-1") { self._showSelectedPlugin(selectedDataCollection,$(this)); //self._makeTheDomChangeOfComboSelect(selector, selectedDataCollection) } }); }, _getSelectedTool : function(parentRef) { return $(parentRef).find("." + this._default.selectMethodList).val(); }, _getSelectedAnalysisMethod : function(parentRef) { var comboRef = $(parentRef).find("." + this._default.analysisMethodComboClass); if (comboRef.length > 0 && comboRef.is(":visible")) { return $(comboRef).val(); } else { return ""; } //return $(parentRef).find("." + this._default.analysisMethodComboClass).val(); }, _initMotifExpressOptions : function(context) { var self = this; var parent = $(context).closest("." + this._default.appContainerClass); $(parent).find("." + self._default.applicationOptionClass).unbind('click'); var selectedTool = $(context).val(); if (selectedTool == "MotifExpress") { $(parent).find("." + self._default.applicationOptionClass).show(); $(parent).find("." + self._default.applicationOptionClass).click(function() { var selectedDataCollection = $(parent).find("." + self._default.dataColomboClass); if ($(selectedDataCollection).is(":visible") && $(selectedDataCollection).val() != "-1") { self._showSelectedPlugin(selectedDataCollection.val(),$(this)); //return; } //$(parent).find("." + self._default.nextButtonContainerClass).hide(); //obj.applicationOption = $(this).find("input[name=applicationOption]:checked").val(); //eval(method)(id, obj); }); // making motif max as the defaukt mthod $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked")[0].checked=true; } else { $(parent).find("." + self._default.applicationOptionClass).hide(); } }, _resetDataMiningCombos : function(comboRef) { var parent = $(comboRef).closest("." + this._default.appContainerClass); var expressionDbContainer = $(parent).find("." + this._default.expressionDbContainer); var dataColContainer = $(parent).find(" ." + this._default.dataColContainer); var analysisMethodContainer = $(parent).find(" ." + this._default.analysisMethodContainer); var toolCombo = $(parent).find("." + this._default.selectMethodList); var comboClass = $(comboRef).attr("class"); if (toolCombo.val() == this._default.manualMotifEntryToolName) { $(analysisMethodContainer).hide(); $(expressionDbContainer).hide(); $(dataColContainer).hide(); } else { if (comboClass == this._default.selectMethodList) { $(analysisMethodContainer).show(); $(expressionDbContainer).hide(); $(dataColContainer).hide(); } else if (comboClass == this._default.analysisMethodComboClass) { $(expressionDbContainer).hide(); $(dataColContainer).hide(); } $container = $(parent).find("." + this._default.actionResultContainer); $container.html(""); } $(parent).find("." + this._default.finishSequence).hide() $(parent).find("." + this._default.finishSequenceFixedClass).hide(); }, /* _clearWorkingArea : function(context) { var parent = $(context).closest("." + this._default.appContainerClass); var actionResultArea = $(parent).find("." + this._default.actionResultContainer); $(actionResultArea).html(""); },*/ _showSelectedPlugin : function(selectedDataCollection,context) { var self = this; var info = null; if (selectedDataCollection) { info = this._appMenuHandler._getWorkIdAndFileNameUsingDataCollection(selectedDataCollection); } var parent = $(context).closest("." + this._default.appContainerClass); var method = $(parent).find("." + self._default.selectMethodList).val(); $container = $(parent).find("." + self._default.actionResultContainer); $container.html("Loading..."); //$(parent).find("." + this._default.applicationOptionClass).hide(); $(parent).find("." + this._default.nextButtonContainerClass).hide(); var date = new Date(); var id = "container_id_" + date.getTime(); var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val(); var fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).html(); $container.attr("id", id); var func = function() { self._callback(parent, self); } var obj = { workId : (info) ? info.workId : "", fileName : (info) ? info.fileName : "", baseSequence : self._baseSequence, tooltip : self._tooltip, callback : func, applicationOption : appOption, fixedSequence : fixedSeq, motifMethod : this._getSelectedAnalysisMethod(parent), dataColl : selectedDataCollection }; /* if (method === "MotifExpress") { //$(parent).find("." + self._default.applicationOptionClass).show(); var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val(); if (!appOption) { appOption = "max"; $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption][value='max']").attr("checked", true); } obj.applicationOption = appOption; $(parent).find("." + self._default.applicationOptionClass).unbind('click'); $(parent).find("." + self._default.applicationOptionClass).click(function() { $(parent).find("." + self._default.nextButtonContainerClass).hide(); $("#" + id).html(""); obj.applicationOption = $(this).find("input[name=applicationOption]:checked").val(); eval(method)(id, obj); }); }*/ eval(method)(id, obj); }, _fillAnalysisMethodCombo : function(selectToolCmbRef) { var parent = $(selectToolCmbRef).closest("." + this._default.appContainerClass); var selectedTool = $(selectToolCmbRef).val(); var analysisMethods = this._appMenuHandler._getFilteredDistinctAnalysisMethods(selectedTool); var analysisMethodCmb = $(parent).find("." + this._default.analysisMethodComboClass); this._fillCombo(analysisMethods, analysisMethodCmb, this._default.analysisMethodComboEmptyOptionText, this._tooltipName.analysisMethod); }, _fillExpressionDBCombo : function(analysisMethodCmbRef) { var parent = $(analysisMethodCmbRef).closest("." + this._default.appContainerClass); var selectedTool = this._getSelectedTool(parent); var selectedAnalysisMethod = $(analysisMethodCmbRef).val(); var expressionDbs = this._appMenuHandler._getFilteredDistinctExpressionDbs(selectedTool,selectedAnalysisMethod); var analysisMethodCmb = $(parent).find("." + this._default.expressionDbComboClass); this._fillCombo(expressionDbs, analysisMethodCmb, this._default.expressionDbComboEmptyOptionText, this._tooltipName.expressionDb); }, _fillDataCollectionCombo : function(expressionDbRef) { var parent = $(expressionDbRef).closest("." + this._default.appContainerClass); var selectedTool = this._getSelectedTool(parent); var selectedAnalysisMethod = this._getSelectedAnalysisMethod(parent); var selectedExpressionDb = $(expressionDbRef).val(); var dataCollections = this._appMenuHandler._getFilteredDistinctDataCollections(selectedTool,selectedAnalysisMethod,selectedExpressionDb); var dataColCmb = $(parent).find("." + this._default.dataColomboClass); this._fillCombo(dataCollections, dataColCmb, this._default.dataColColomboEmptyOptionText, this._tooltipName.dataCollection); }, _fillCombo : function(optionsArr, cmbRef, firstOptionText, firstOptionToolTipKey) { $(cmbRef).empty(); var toolTip = this._tooltip.getByKey(firstOptionToolTipKey); $(cmbRef).append("<option value='-1' title='"+ toolTip +"'>"+ firstOptionText +"</option>"); for (var index = 0 ; index < optionsArr.length ; index++) { var option = optionsArr[index]; toolTip = this._tooltip.getByKey(option); $(cmbRef).append("<option value='"+ option + "' title='"+ toolTip +"'>"+ option +"</option>"); } }, _fillEmptyBaseSequence : function() { var self = this, sb = []; for (var i = 0; i < self._default.baseSequenceMaxLength; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } $baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass); $baseInput.val(sb.join("")); }, _loadPluginScriptList : function(workId, fileName, property) { var getTripleList = function(tripleList) { $.each(tripleList, function(tKey, tVal) { LinkDataUtil.loadScript(tVal.object); }); } LinkData.getTriplesByProperty(workId, fileName, property, getTripleList); }, _changeMethodList : function(dbKey) { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $select.attr("title", self._getToolTip(self._tooltipName.selectTool)); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Tool --</option>"); if (dbKey == -1) { return; } var arr = dbKey.split("|"); var workId = arr[0]; var fileName = arr[1]; $.each(self._methodList, function(key, method) { self._addValidMethod($select, workId, fileName, method); }); }, _addValidMethod : function($select, workId, fileName, method) { var self = this; var getFilesByTag = function(fileList) { if (!fileList) { return; } $.each(fileList, function(fKey, fName) { if (fName === fileName) { var tooltip = self._getToolTipByToolName(method); tooltip = (tooltip) ? tooltip : ""; $select.append("<option value='" + method + "' title='" + tooltip + "'>" + method + "</option>"); return false; } }); } LinkData.getFilesByTag(workId, method, getFilesByTag); }, _initUseButtonListener : function() { var self = this; $("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).click(function() { self._initDefaultContainer(); $txtSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass); $fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass); self._hideError(); if ($txtSeq.val().length > self._default.baseSequenceMaxLength) { self._showError(self._default.errorMessageMaximumSequence.replace("{0}", self._default.baseSequenceMaxLength)); return; } if ($txtSeq.val().length < self._default.baseSequenceMaxLength) { var tmpVal = $txtSeq.val(); var eVal = self._getExtraDefaultSequence(self._default.baseSequenceMaxLength - $txtSeq.val().length); $txtSeq.val(eVal + tmpVal); $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("size", 500); } self._baseSequence = $txtSeq.val().toString().toLowerCase() + $fixedSeq.html(); if (!self._baseSequence || self._baseSequence.length < self._default.baseSequenceMinLength) { self._showError(self._default.errorMessageEnterSequence.replace("{0}", self._default.baseSequenceMinLength)); } else { //$txtSeq.attr('readonly', true).addClass("noborder"); $(this).hide(); $("." + self._default.appContainerClass).show(); $("." + self._default.appContainerClass + " ." + self._default.expressionDbContainer).hide(); $("." + self._default.appContainerClass + " ." + self._default.dataColContainer).hide(); $("." + self._default.appContainerClass + " ." + self._default.analysisMethodContainer).hide(); $("." + self._default.appContainerClass + " ." + self._default.nextButtonContainerClass).hide(); $("." + self._default.appContainerClass + " ." + self._default.finishSequence).hide() } }); }, _callback : function(parent, self) { if (self._isSelectedManualMotif(parent)) { $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).hide(); //self._initNextButtonListener(); } else { $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).show(); $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).attr("title", self._getToolTip(self._tooltipName.finishNow)); self._initFinishNowButtonListener(); } $(parent).find("." + self._default.nextButtonContainerClass).show(); $(parent).find("." + self._default.finishSequence).hide(); $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).attr("title", self._getToolTip(self._tooltipName.next)); $(parent).find("." + self._default.nextButtonContainerClass).show(); self._initNextButtonListener(); }, _isSelectedManualMotif : function(parent) { var toolCombo = $(parent).find("." + this._default.selectMethodList); var selectedTool = toolCombo.val(); if (selectedTool == this._default.manualMotifEntryToolName) { return true; } else { return false; } }, _initNextButtonListener : function() { var self = this; $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).unbind('click'); $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).click(function() { $parent = $(this).closest("." + self._default.appContainerClass); $parent.find("." + self._default.nextButtonContainerClass).hide(); $(parent).find("." + self._default.finishSequence).hide() var clone = $parent.clone(true); $(clone).find("." + self._default.applicationOptionClass).hide(); var text = $(clone).find(".replaceSequence").text(); if (text && text.trim().length != 0) { self._baseSequence = text; } $(clone).find("." + self._default.actionResultContainer).html(""); $(clone).find("." + self._default.nextButtonContainerClass).hide(); $(clone).find("." + self._default.expressionDbContainer).hide(); $(clone).find(" ." + self._default.dataColContainer).hide(); $(clone).find(" ." + self._default.analysisMethodContainer).hide(); $parent.parent().append(clone); }); }, _initFinishNowButtonListener : function() { var self = this; $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).unbind('click'); $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.nextButtonContainerClass).hide(); $(parent).find("." + self._default.finishSequence).hide() var gene = $(parent).find(".replaceSequence .gene").val(); var geneType = $(parent).find(".replaceSequence .geneType").val(); if (gene && geneType) { var callback = function(bSequence) { self._showFinishedBaseSequence(parent, bSequence); } self._appBaseLineSequence.getBaseSequence(gene, geneType, callback); } else { self._showFinishedBaseSequence(parent,self._baseSequence); } }); }, _showFinishedBaseSequence : function(parent, bSequence) { var self = this; var defaultSequence = $(parent).find(".replaceSequence").text() $(parent).find(".wrappedSequenceMotif").hide(); var html = self._getFinishedBaseSequence(defaultSequence, bSequence); var fixedSequence = self._getFixedSequence(); $(parent).find("." + self._default.finishSequenceFixedClass).html(fixedSequence); $(parent).find("." + self._default.finishSequenceFixedClass).show(); $(parent).find("." + self._default.finishSequence).show(); $(parent).find("." + self._default.finishSequence).html(html); $(parent).find("." + self._default.finishSequence).scrollLeft(10000); }, _getFixedSequence : function() { var fixedSequence = $("#" + this._default.baseSequenceContainerId + " ." + this._default.fixedSequenceClass).html(); return fixedSequence; }, _getFinishedBaseSequence : function(defaultSequence, bSequence) { var self = this, sb = []; var fixedSequence = this._getFixedSequence(); var uptoFixedSequence = defaultSequence.length - fixedSequence.length; for (var i = 0; i < defaultSequence.length; i++) { if (i > uptoFixedSequence - 1) { continue; } var dChar = defaultSequence.charAt(i); var bChar = bSequence.charAt(i); if (bChar) { if (dChar !== self.CHAR_SEQ_EMPTY) { sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>"; } else { sb[sb.length] = bChar; } } else { sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>"; } } return sb.join(""); }, _getExtraDefaultSequence : function(count) { var self = this, sb = []; for (var i = 0; i < count; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } return sb.join(""); }, _getDatabaseOptionKey : function(workId, fileName) { return workId + "|" + fileName; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _showError : function(message) { var self = this; $errMsgEl = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass); $errMsgEl.html(message); $errMsgEl.show(); }, _hideError : function() { var self = this; $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass).hide(); }, _getToolTipByFileName : function(fileName) { var self = this; if (fileName) { if (fileName.toLowerCase().indexOf(self._tooltipName.atGeneExpress) > -1) { return self._getToolTip(self._tooltipName.atGeneExpress); } else if (fileName.toLowerCase().indexOf(self._tooltipName.diunal) > -1) { return self._getToolTip(self._tooltipName.diunal); } } }, _getToolTipByToolName : function(tool) { var self = this; if (tool) { if (tool.toLowerCase().indexOf(self._tooltipName.motifExpress) > -1) { return self._getToolTip(self._tooltipName.motifExpress); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifCircatian) > -1) { return self._getToolTip(self._tooltipName.motifCircatian); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifRank) > -1) { return self._getToolTip(self._tooltipName.motifRank); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifQuery) > -1) { return self._getToolTip(self._tooltipName.motifQuery); } else if (tool.toLowerCase().indexOf(self._tooltipName.inputMotif) > -1) { return self._getToolTip(self._tooltipName.inputMotif); } } }, _getToolTip : function(key) { return this._tooltip.getByKey(key); } }; Application.MenuHandler = function() { this._init.apply(this,arguments); } Application.MenuHandler.prototype = { _fullList : [], _currentFilteredList : [], _workId : null, _fileName : null, _fileProperties : null, _properties : { motifAnalysisMethod : "motif%20analysis%20method", geneExpressionData : "gene%20expression%20data", menuDisplayName : "menu%20display%20name", toolsList : "tool%20list", workIdInTest : "test.linkdata.org", workIdPublic : "linkdata.org", }, _tags : { menuDataSourceTag : "menu" }, _defaults : { linkdataTestUrl : "test.linkdata.org", linkdataPublicUrl : "linkdata.org", }, _init : function(args) { this._initMenuDataSource(); }, _fillFileProperties : function() { var self = this; var setProperties = function(props) { self._fileProperties = props; }; LinkData.getProperties(this._workId,this._fileName,setProperties); }, _initMenuDataSource : function() { var self = this; var foundMenuFiles = []; var loadMenuFiles = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { var obj = { workId : wId, fileName : fName }; foundMenuFiles.push(obj); }); }); self._foundMenuFiles = foundMenuFiles; self._loadMenuFileContent(foundMenuFiles); self._fillFileProperties(); }; LinkData.getFilesByTag(null, this._tags.menuDataSourceTag, loadMenuFiles); }, _loadMenuFileContent : function(menuFiles) { var self = this; var addFileContent = function(triples) { for (var index = 0 ; index < triples.length ; index++) { self._fullList.push(triples[index]); } //if (menuFiles.length > 0) { // self._loadMenuFileContent(menuFiles); //} }; if (menuFiles.length > 1) { alert("There can be only one file that can be tagged with 'menu'"); return; } if (menuFiles.length == 0) { return; } var obj = menuFiles.shift(); // removing the first element this._fileName = obj.fileName; this._workId = obj.workId; LinkData.getTriples(this._workId,this._fileName,addFileContent,{start:1, end:2000}); }, _getFilteredAnalysisMethodTriples : function(toolName) { if (!(toolName)) return this._fullList; this._currentFilteredList = []; var listByTool = this._getTriplesByProperty(this._properties.toolsList,this._fullList); if (!listByTool) return null; var filteredList = []; for (var index = 0 ; index < listByTool.length ; index++) { var triple = listByTool[index]; if (triple.object) { var toolList = triple.object.split(","); for (var index1 = 0 ; index1 < toolList.length ; index1++) { var tool = toolList[index1]; if (tool.trim() == toolName.trim()) { var subject = triple.subject; var otherPropTripleList = this._getTriplesBySubject(subject); for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) { var propTriple = otherPropTripleList[index1]; //this._currentFilteredList.push(propTriple); filteredList.push(propTriple); } break; } } } } return filteredList; /*this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.motifAnalysisMethod); return distinctList;*/ }, _getFilteredDistinctAnalysisMethods : function(toolName) { var filteredList = this._getFilteredAnalysisMethodTriples(toolName); this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.motifAnalysisMethod,filteredList); return distinctList; }, _getFilteredExpressionDbTriples : function(toolName,analysisMethodName) { var listByTool = this._getFilteredAnalysisMethodTriples(toolName); var listByAnalysisMethod = this._getTriplesByProperty(this._properties.motifAnalysisMethod,listByTool); if (!listByAnalysisMethod) return null; var filteredList = []; for (var index = 0 ; index < listByAnalysisMethod.length ; index++) { var triple = listByAnalysisMethod[index]; if (triple.object) { var analysisMethod = triple.object; if (analysisMethod.trim() == analysisMethodName.trim()) { var subject = triple.subject; var otherPropTripleList = this._getTriplesBySubject(subject); for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) { var propTriple = otherPropTripleList[index1]; //this._currentFilteredList.push(propTriple); filteredList.push(propTriple); } } } } return filteredList /*this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.geneExpressionData); return distinctList;*/ }, _getFilteredDistinctExpressionDbs : function(toolName,analysisMethodName) { var filteredList = this._getFilteredExpressionDbTriples(toolName,analysisMethodName); this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.geneExpressionData,filteredList); return distinctList; }, _getFilteredDataCollectionTriples : function(toolName,analysisMethodName,expressionDbName) { var listByExpDbs = this._getFilteredExpressionDbTriples(toolName,analysisMethodName); var listByGeneExp = this._getTriplesByProperty(this._properties.geneExpressionData,listByExpDbs); if (!listByGeneExp) return null; var filteredList = []; for (var index = 0 ; index < listByGeneExp.length ; index++) { var triple = listByGeneExp[index]; if (triple.object) { var exprssionDb = triple.object; if (exprssionDb.trim() == expressionDbName.trim()) { var subject = triple.subject; var otherPropTripleList = this._getTriplesBySubject(subject); for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) { var propTriple = otherPropTripleList[index1]; //this._currentFilteredList.push(propTriple); filteredList.push(propTriple); } } } } return filteredList; /*this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.menuDisplayName); return distinctList;*/ }, _getFilteredDistinctDataCollections : function(toolName,analysisMethodName,expressionDbName) { var filteredList = this._getFilteredDataCollectionTriples(toolName,analysisMethodName,expressionDbName); this._currentFilteredList = filteredList; var distinctList = this._getDistinctObjectList(this._properties.menuDisplayName,filteredList); return distinctList; }, _getWorkIdAndFileNameUsingDataCollection : function(dataCollectionName) { var matchingList = []; var outObj = null; var listByDataCollection = this._getTriplesByProperty(this._properties.menuDisplayName,this._currentFilteredList); if (!listByDataCollection) return null; for (var index = 0 ; index < listByDataCollection.length ; index++) { var triple = listByDataCollection[index]; var dataCollection = triple.object; if (dataCollection == dataCollectionName) { matchingList.push(triple); } } if (matchingList.length > 1) { // this a error. because there can be only one matching triple alert("Data file error"); } else { // getting other triples for found one var subject = matchingList.shift().subject; var workId = null; var otherPropTripleList = this._getTriplesBySubject(subject); var workIdProperty = this._getWorkIdProperty(); for (var index=0 ; index < otherPropTripleList.length ; index++) { var triple = otherPropTripleList[index]; var prop = this._getProperty(triple.property); if (prop == workIdProperty) { workId = triple.object; break; } } var workIdComps = workId.split("/"); var subjectComps = subject.split("#"); outObj = { fileName : subjectComps[subjectComps.length-1], workId : workIdComps[workIdComps.length-1], }; } return outObj; }, _getProperty : function(propertyUrl) { var comps = propertyUrl.split("#"); return comps[comps.length-1]; }, _getWorkIdProperty : function() { var hostName = window.location.hostname; if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) { return this._properties.workIdInTest; } else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) { return this._properties.workIdPublic; } }, _getTriplesByProperty : function(propName,currentList) { /* this function first will find the triple with the passed property and then this will take the subject of it and will find other properties of that subject */ var filteredList = []; //var currentList = this._getCurrentUsingList(); for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var prop = this._getProperty(triple.property); if (prop == propName) { filteredList.push(triple); //var otherPropTripleList = this._getTriplesBySubject(subject); //for (var index1 = 0 ; index1 < otherPropTripleList.length ; index1++) { // var propTriple = otherPropTripleList[index1]; // filteredList.push(propTriple); //} } } return filteredList; }, _getTriplesBySubject : function(subject) { var filteredList = []; var currentList = this._getCurrentUsingList(); for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var triSubject = triple.subject; if (triSubject.trim() == subject.trim()) { filteredList.push(triple); } if (filteredList.length == this._fileProperties.length) { break; } } return filteredList; }, // returns a string array _getDistinctObjectList : function(propName,currentList) { var distinctList = []; for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var prop = triple.property; if (prop && prop.indexOf(propName) != -1) { var objVal = triple.object; if (distinctList.indexOf(objVal) == -1) { distinctList.push(objVal); } } } return distinctList; }, _getCurrentUsingList : function() { if (this._currentFilteredList.length == 0) { return this._fullList; } else { return this._currentFilteredList; } }, } Application.baseLineSequence = function() { this._init.apply(this, arguments); }; Application.baseLineSequence.prototype = { _attedSequenceInfo : null, _ppdbSequenceInfo : null, _default : { sequenceProperty : "baseline%20sequence" }, _tag : { attedBaseSequenceTag : "atted_baseLineSequence", ppdbBaseSequenceTag : "ppdb_baseLineSequence" }, _init : function() { this._attedSequenceInfo = {}; this._ppdbSequenceInfo = {}; this._initBaseSequenceFile(); }, _initBaseSequenceFile : function() { this._initAttedBaseSequenceFile(); this._initPpdbBaseSequenceFile(); }, _initAttedBaseSequenceFile : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initAttedInfo(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._tag.attedBaseSequenceTag, getFilesByTag); }, _initPpdbBaseSequenceFile : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initPpdbInfo(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._tag.ppdbBaseSequenceTag, getFilesByTag); }, _initAttedInfo : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { var propOnly = pValue.split("#")[1]; if (propOnly == self._default.sequenceProperty) { self._attedSequenceInfo.workId = workId; self._attedSequenceInfo.fileName = fileName; self._attedSequenceInfo.property = pValue; return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _initPpdbInfo : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { var propOnly = pValue.split("#")[1]; if (propOnly == self._default.sequenceProperty) { self._ppdbSequenceInfo.workId = workId; self._ppdbSequenceInfo.fileName = fileName; self._ppdbSequenceInfo.property = pValue; return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getAttedSubjectUrl : function(gene) { return "http://atted.jp/data/locus/" + gene + ".html"; }, _getPpdbSubjectUrl : function(gene) { return "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene; }, _getAttedBaseSequence : function(gene, callback) { var self = this; var workId = self._attedSequenceInfo.workId; var fileName = self._attedSequenceInfo.fileName; var property = self._attedSequenceInfo.property; var subject = self._getAttedSubjectUrl(gene); var getObjects = function(objList) { callback(objList[0]); } LinkData.getObjects(workId, fileName, subject, property, getObjects); }, _getPpdbBaseSequence : function(gene, callback) { var self = this; var workId = self._ppdbSequenceInfo.workId; var fileName = self._ppdbSequenceInfo.fileName; var property = self._ppdbSequenceInfo.property; var subject = self._getPpdbSubjectUrl(gene); var getObjects = function(objList) { callback(objList[0]); } LinkData.getObjects(workId, fileName, subject, property, getObjects); }, getBaseSequence : function(gene, geneType, callback) { var self = this; if ("ATTED" === geneType) { self._getAttedBaseSequence(gene, callback); } else if ("PPDB" === geneType) { self._getPpdbBaseSequence(gene, callback); } else { // error } } }; Application.tooltip = function() { this._init.apply(this, arguments); }; Application.tooltip.prototype = { _toolTipList : null, _default : { explanationProperty : "explanation" }, _init : function() { this._toolTipList = []; this._initToolTip(); }, _initToolTip : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._getFilePropertyList(workId, fileName); }); }); } LinkData.getFilesByTag(null, "tooltip", getFilesByTag); }, _getFilePropertyList : function(workId, fileName) { var self = this; var index = new Application.index(1, 10000); var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.explanationProperty) > -1) { self._getSubjectList(workId, fileName, pValue, index); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getSubjectList : function(workId, fileName, property, index) { var self = this; var getSubjects = function(subjectList) { self._getPropertyList(subjectList, workId, fileName, property, index); } LinkData.getSubjects(workId, fileName, getSubjects, index); }, _getPropertyList : function(subjectList, workId, fileName, property, index) { var self = this; var getTriplesByProperty = function(tripleList) { self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index); } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index); }, _addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) { var self = this; for (var i = 0; i < subjectList.length; i++) { var key = self._getLabelAfterHash(subjectList[i]); if (tripleList[i]) { var value = tripleList[i].object; self._addToolTip(key, value); } //var value = tripleList[i].object; //self._addToolTip(key, value); } if (subjectList && subjectList.length == index.getItemCount()) { self._getSubjectList(workId, fileName, property, index.increment()); } }, _addToolTip : function(key, tooltip) { var obj = {}; obj.key = key; obj.tooltip = tooltip; this._toolTipList.push(obj); }, getByKey : function(key) { var self = this, tooltip; $.each(self._toolTipList, function(objKey, obj) { if (obj.key.toString().toLowerCase() === key.toString().toLowerCase()) { tooltip = obj.tooltip; return false; } }); return (tooltip) ? tooltip : ""; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.index = function() { this._init.apply(this, arguments); } Application.index.prototype = { _start : null, _end : null, _init : function(start, end) { this._start = start; this._end = end; }, getIndex : function() { return {start : this._start, end : this._end}; }, getItemCount : function() { return (this._end - this._start + 1); }, increment : function() { var itemCount = this.getItemCount(); this._start = this._start + itemCount; this._end = this._end + itemCount; return {start : this._start, end : this._end}; }, getStartIndex : function() { return this._start; }, getEndIndex : function() { return this._end; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 100; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; }, setMaxRetryCount : function(no) { this._maxRetry = no; } }; Application.MotifConflication = function() { this._init.apply(this, arguments); }; function _deleteUserSequence(sequence,containerId,comp) { var userSequenceArea = null; //var t = new Application.sequence(); //t._deleteUserSequence(sequence); $("#" + containerId + " .resultArea .userSequence").each(function() { var seq = $(this).find(".hdnSequence").val(); if (seq == sequence) { userSequenceArea = this; return false; } }); if (userSequenceArea) { $("#" + containerId + " .resultArea ." + sequence).remove(); $(userSequenceArea).parent().remove(); } } /* Application.MotifConflication.prototype = { _motifConflictConfirmDialogId : null, _containerId : null, _resultAreaClass : "resultArea", _baseSequenceLength : 550, _baseSequence : null, _appSequence : null, replaceSequenceClass : "replaceSequence", htmlRenderFunction : null, htmlSetFunctionOwner : null, defaults : { conflictionDialogTitle : "Confliction", }, _init : function(para,appSequnce) { //this._containerId = para; this._containerId = para; //this._resultAreaClass = para.resutAreaClass; //this._baseSequenceLength = para.baseSequenceLength; //this._appSequence = appSequnce; }, _setAppSequnce : function(appSequence) { this._appSequence = appSequence; }, _setHtmlSetFunction : function(func) { this.htmlRenderFunction = func; }, _setHtmlSetFunctionOwner : function(owner) { this.htmlSetFunctionOwner = owner; }, _initConflictConfirmDialogView : function() { var sb = [], date = new Date(); //self._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + self._containerId + "_" + date.getTime(); this._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + date.getTime(); sb[sb.length] = "<div id='" + this._motifConflictConfirmDialogId + "' class='hidden' style='width:200px'>"; sb[sb.length] = "<div>New motif overlaps with old one. Which one should be kept in overalp regions?</div>"; sb[sb.length] = "<div class='option'>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='new'/> New</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='old'/> Old</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='discard'/> Discard new motif</label></div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<label><input type='checkbox' checked=checked class='motifReplaceApplyToAllMotifMax' value='applytoall'/> Apply to all</label>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); console.log(this._containerId); }, _initMotifConflictConfirmDialog : function() { var self = this; $("#" + self._motifConflictConfirmDialogId).dialog({ autoOpen: false, width: 420, dialogClass : "motifConflictionDialog" }); }, _handleConfliction : function(conflictArray) { var self = this; if (conflictArray.length > 0) { var arr = conflictArray[0].split("|"); var bArray = self._getConflictConfirmDialogButtonArray(conflictArray); var dialogTitle = this.defaults.conflictionDialogTitle + " - " + arr[0] + "[" + arr[1] + "]"; $("#" + self._motifConflictConfirmDialogId).find("input[name='motifReplaceOption'][value='new']").attr("checked", "checked"); var checkBox = $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMax']"); $(checkBox).attr("checked",$(checkBox).is(':checked')); //$("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); $("#" + self._motifConflictConfirmDialogId).dialog({title : dialogTitle}); $("#" + self._motifConflictConfirmDialogId).dialog({buttons : bArray}); $("#" + self._motifConflictConfirmDialogId).dialog("open"); } else { $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMax']").attr("checked", "checked"); } }, _getConflictConfirmDialogButtonArray : function(conflictArray) { var self = this; return [ { text: "Done", click : function() { $(this).dialog("close"); var option = $(this).find("input[name='motifReplaceOption']:checked").val(); var isApplyToAll = $(this).find(".motifReplaceApplyToAll").is(":checked"); self._replaceWithOption(option, isApplyToAll, conflictArray); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ]; }, _replaceWithOption : function(option, isApplyToAll, conflictArray) { var self = this; if (isApplyToAll) { self._replaceAllWithOption(option, conflictArray); $("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); } else { var value = conflictArray.splice(0, 1); var arr = value[0].split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); self._handleConfliction(conflictArray); } }, _replaceAllWithOption : function(option, conflictArray) { var self = this, html = oldSequence; var oldSequence = $("#" + self._containerId + " ." + self.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self.resultAreaClass + " .baseSequence").html(); } $.each(conflictArray, function(key, conflict) { var arr = conflict.split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); }); }, _replaceSequenceByOption : function(option, seq, pos) { var self = this; var oldSequence = $("#" + self._containerId + " ." + self.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequenceLength, seq, pos); var seqArray = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(seqArray); var html = oldSequence; if (option === "new") { html = self._appSequence.getHtmlByReplacingNewSequence(oldSequence, newSequence); } else if (option === "old") { html = self._appSequence.getHtmlByReplacingOldSequence(oldSequence, newSequence); } //self._doReplaceWithHtml(html); self.htmlRenderFunction.call(html); }, _hasConfliction : function(seq, pos, oldSequence) { var self = this; if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequenceLength, seq, pos); var array = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(array); for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); if (nChar !== "-" && oChar !== "-" && nChar !== oChar) { return true; } } return false; }, } */ $(document).ready(function() { new Application.genocon(); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } #gcAppContainer { width: 900px; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 165px; } input.baseSequence { /*width: 100%;*/ } .highlight-sequence { font-weight: bold; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; white-space: nowrap; } .resultArea .userSequence { white-space: nowrap; float: left; } .finishSequence, .replaceSequenc { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; width: 100%; overflow: auto; white-space: nowrap; } .wrappedSequenceMotif { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; overflow: auto; word-wrap: break-word; white-space: normal; width:100%; height:90px; word-break: break-all; } .replace { color: #E80010; } .baseErrorMessage, .errorMessage { color: black; /*text-align: center;*/ margin-bottom: -10px; margin-top: 10px; } .errorText { color: #FF0000; } .applicationContainer { background-color: #F6F6F6; border: 1px solid #CCCCCC; margin: 5px 0 0; padding: 5px; } .actionButtonContainer { text-align: right; } .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .row { padding: 5px 0; } .row:after { clear: left; content: ""; display: block; } .row input[type="text"] { width: 200px; } .row .externalLink { margin: 0 5px; } .noborder { border: medium none; } #baseSequenceContainer .baseSequenceBox { width: 100%; overflow: auto; white-space: nowrap; } #baseSequenceContainer .baseSequenceBox span, #baseSequenceContainer .baseSequenceBox .baseSequence { font-family: Courier; } #baseSequenceContainer .baseSequenceBox .fixedSequence { position: relative; left: -6px; color: #AAAAAA; font-weight: bold; } .applicationContainer .nextButtonContainer { margin-top: 10px; } .databaseInfo .motif { width: 70%; } /** * button css */ a.useButton { width: 150px; } .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; margin-left: 200px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; } .loadingImageContainer .loadingMessage { color: #FF0000; } .motifConflictionDialog .option { margin: 10px; } .motifViewDialog { margin-top: 10px; } .motifViewDialog .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; width : 200px; } .motifViewDialog .motifviewinfo { float: right; margin-top: -150px; position: relative; width: 350px; } .deletelink { cursor: pointer; } .deletelink img { margin-bottom: -3px; } .manualMotifView .manualMotifViewInfo { float: right; height: 90px; margin-right: 10px; margin-top: -65px; position: relative; width: 380px; } .baseSequenceBox textarea { resize: none; width: 490px; height: 115px; } .fixedSequenceCheckBox { float: right; margin-right: 210px; margin-top: -115px; } .fixedSequenceMsg { float: right; margin-right: 20px; margin-top: -40px; } .fixedSequenceMotif { display: inline; float: right; font-family: "Courier New","Lucida Console"; margin-top: -15px; } .resultAreaUserMessageClass { color: #0A5DA6; font: bold 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; font-size: 12px; font-weight: bold; margin-top: -6px; margin-bottom: 4px; } .finishSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; font-family: "Courier New","Lucida Console"; height: 100px; margin: 10px 0 0; overflow: auto; width: 480px; word-break: break-all; word-wrap: break-word; white-space: normal; } .finishSequenceFixed { display: inline; float: right; font-family: "Courier New","Lucida Console"; margin-top: -15px; } .manualsequence { float: right; height: 40px; overflow: auto; width: 300px; margin-bottom: 5px; } .motifviewsequence { float: right; height: 40px; margin-bottom: 5px; overflow: auto; width: 240px; }
<div id="gcAppContainer"> <p> This is an interactive tutorial PromoterCAD for MotifRanking plugin. When you hover the mouse over components, instructions will appear in floating tooltip. </p> <div id="baseSequenceContainer"> <div class="label baseSequenceLabel">Base Sequence</div> <div class="baseSequenceBox"> <span> <textarea type="text" cols=45 rows=5 class="baseSequence" value="" disabled=true maxlength=500> </textarea> </span> <span class="fixedSequence">GATCCCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG</span> </div> <div> <div class="fixedSequenceCheckBox"><input type="checkbox" id="chkEmptySequnce" value="true" checked=true>Start with empty sequence</div> <div class="fixedSequenceMsg">Minimal Promoter (fixed)</div> </div> <div style="margin-top:5px;"><a class="useButton btn btn-green">Start promoter design</a></div> <div class="baseErrorMessage hidden"></div> </div> <div class="applicationContainer hidden"> <div class="actionButtonContainer"> <span class="appSummery"></span> <span class="collapseButton actionBtn" title="collapse">_</span> <span class="expandButton actionBtn" title="expand">+</span> <span class="removeButton actionBtn" title="remove">x</span> <br clear="all"/> </div> <div class="applicationDataContainer"> <div class="row"> <div class="label left optionListLabel">Select Tool</div> <div class="left"> <select class="optionList"></select> <span class="applicationOptionRadio hidden"> <input type="radio" name="applicationOption" value="max" checked="checked"/> Max <input type="radio" name="applicationOption" value="min"/> Min </span> </div> </div> <div class="row hidden analysisMethodContainer"> <div class="label left analysisMethodLabel">Analysis Method</div> <div class="left"> <select class="analysisMethod"></select> </div> </div> <div class="row hidden expressionDbContainer"> <div class="label left expressionDbLabel">Expression DataBase</div> <div class="left"> <select class="expressionDb"></select> </div> </div> <div class="row hidden dataColContainer"> <div class="label left dataColLabel">Data Collection</div> <div class="left"> <select class="dataCol"></select> </div> </div> <div class="actionResultContainer"></div> <div class="nextButtonContainer hidden"> <a class="btn nextButton">Next</a> <a class="btn finishNow">Finish Now</a> </div> <div class="finishSequence hidden"></div> <div class="finishSequenceFixed hidden"></div> </div> </div> </div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
Speedup Lists of Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
3384 Downloads, 19 Applications
Lists for the Diurnal and ATTED-II mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by circadian amplitude. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Expression X hours </th> <td> The genes ranked by absolute expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> <tr> <th nowrap> condition:Conditions_Range </th> <td> The genes ranked by absolute expression level under the given condition, and for the given circadian phase range. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_0to4_top.html#work_information'>DiurnalHours_ATTED_0to4_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 0 to 4 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_4to8_top.html#work_information'>DiurnalHours_ATTED_4to8_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 4 to 8 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_8to12_top.html#work_information'>DiurnalHours_ATTED_8to12_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 8 to 12 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_12to16_top.html#work_information'>DiurnalHours_ATTED_12to16_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 12 to 16 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_16to20_top.html#work_information'>DiurnalHours_ATTED_16to20_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 16 to 20 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_20to24_top.html#work_information'>DiurnalHours_ATTED_20to24_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 20 to 24 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_top.html#work_information'>DiurnalHours_ATTED_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by circadian amplitude. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_bottom.html#work_information'>DiurnalHours_ATTED_bottom</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the bottom 1000 genes ranked by circadian amplitude. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_all.html#work_information'>DiurnalHours_ATTED_all</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table>
DiurnalHours_ATTED_0to4_top
[
result_top
]
DiurnalHours_ATTED_12to16_top
[
result_top
]
DiurnalHours_ATTED_16to20_top
[
result_top
]
DiurnalHours_ATTED_20to24_top
[
result_top
]
DiurnalHours_ATTED_4to8_top
[
result_top
]
DiurnalHours_ATTED_8to12_top
[
result_top
]
DiurnalHours_ATTED_all
DiurnalHours_ATTED_bottom
[
result_bottom
]
DiurnalHours_ATTED_top
Data for New Promoter CAD App
Contributor:Masahiro Mochizuki
Update:Feb 26, 2013
1322 Downloads, 5 Applications
Application_Plugins_for_Synthetic_Promoter_Design_new_plus_MotifRanking
[
method
]
PromoterCAD_Data_Tables_plus_MotifRanking
[
menu
]
tooltip_PromoterCAD_menus_buttons
[
tooltip
]
tooltip_PromoterCAD_menus_buttons_tutorial
[
tooltip
]
Speedup Lists of Developmental Genomic (AtGenExpress + PPDB promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
2152 Downloads, 21 Applications
Lists for the AtGenExpress and PPDB mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by absolute expression level. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s341i/AtGenExpress_PPDB_top.html#work_information'>AtGenExpress_PPDB_top</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s341i/AtGenExpress_PPDB_bottom.html#work_information'>AtGenExpress_PPDB_bottom</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the bottom 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s341i/AtGenExpress_PPDB_all.html#work_information'>AtGenExpress_PPDB_all</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by absolute expression level. </td> </tr> </table>
AtGenExpress_PPDB_all
AtGenExpress_PPDB_bottom
[
result_bottom
]
AtGenExpress_PPDB_top
[
result_top
]
PromoterCAD Data Tables
Contributor:Koro_Nishikata
Update:Mar 7, 2013
363 Downloads, 7 Applications
<p> This will allow the PromoterCAD Application to find the appropriate tools, the input data and the gene rank list. </p>
PromoterCAD_Data_Tables
[
menu
]
PromoterCAD_tooltips
Contributor:Koro_Nishikata
Update:May 16, 2013
1193 Downloads, 13 Applications
To facilitate the usability of PromoterCAD, we provide the tooltip informartion. Then it is easy for users to undergo the promoter motif manipulation.
tooltip_AtGenExpress
[
tooltip
]
tooltip_DataTable
[
tooltip
]
tooltip_PromoterCAD_menus_buttons
[
tooltip
]
PromoterCAD plugin tools
Contributor:GenoCon
Update:Mar 8, 2013
613 Downloads, 7 Applications
This file is used to register new plugin tools for use in forked versions of PromoterCAD.
Application_Plugins_for_Synthetic_Promoter_Design_new
[
method
]
PromoterCAD_plugins
Developmental Genomic (AtGenExpress + PPDB promoter motif) Full
Contributor:GenoCon
Update:Jan 22, 2013
4761 Downloads, 27 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). For each motif, we calculated the position relative to the TSS as determined experimentally (PPDB). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> PPDB motif </th> <td> A link to the PPDB database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif type </th> <td> Type of the PPDB promoter motif. The identified octamers have been classified into regulatory element group (REG), TATA box, and Y Patch. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site (TSS). </td> </tr> <tr> <th nowrap> genome_version </th> <td> The genome version of annotated motifs. </td> </tr> <tr> <th nowrap> TAIR_gene </th> <td> Gene information associated with the motifs. </td> </tr> <tr> <th nowrap> chromosome </th> <td> Chromosome number the gene belongs. </td> </tr> <tr> <th nowrap> position start </th> <td> The absolute start position of the motif. </td> </tr> <tr> <th nowrap> position start from TSS peak </th> <td> The position of the motif start relative to the TSS peak. </td> </tr> <tr> <th nowrap> position end </th> <td> The absolute end position of the motif. </td> </tr> <tr> <th nowrap> position end from TSS peak </th> <td> The position of the motif end relative to the TSS peak. </td> </tr> <tr> <th nowrap> strand </th> <td> The strand of the feature. + for positive strand, - for minus strand. </td> </tr> <tr> <th nowrap> TSS peak position </th> <td> The absolute position of the TSS peak, which is the most probable TSS position determined by the CT-MPSS method. </td> </tr> <tr> <th> TSS peak position from Initial codon </th> <td> The position of the TSS peak relative to Initial codon. </td> </tr> <tr> <th nowrap> Initial codon </th> <td> The absolute position of the Initial codon. </td> </tr> <tr> <th nowrap> label:Conditions </th> <td> The gene expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Flowering.html#work_information'>AtGenExpress_PPDB_Flowering</a> </td> <td> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Fruit_Seeds.html#work_information'>AtGenExpress_PPDB_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Leaf.html#work_information'>AtGenExpress_PPDB_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Root.html#work_information'>AtGenExpress_PPDB_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Seedling.html#work_information'>AtGenExpress_PPDB_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Stem.html#work_information'>AtGenExpress_PPDB_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Whole_Plant.html#work_information'>AtGenExpress_PPDB_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/Octamer_elements.html#work_information'>Octamer_elements</a> </td> <td> A list of the 8mer sequence motifs from PPDB. This table lists each 8mer along with the appropriate median position from the TSS, calculated from all 8mers. </td> </tr> </table>
AtGenExpress_PPDB_Flowering
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Fruit_Seeds
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Leaf
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Root
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Seedling
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Stem
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Whole_Plant
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
Octamer_elements
[
method
]
Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Jan 15, 2013
9411 Downloads, 27 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the CEG motifs as calculated by ATTED-II. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style="text-align:left;"> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site. </td> </tr> <tr> <th nowrap> motif </th> <td> A link to the database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> CEG </th> <td> The Coexpression Expression Group score as calculated by ATTED-II. </td> </tr> <tr> <th nowrap> Probe Condition </th> <td> The strain and growth condition of the 44 hour experiment. </td> </tr> <tr> <th nowrap> Phase </th> <td> The phase of circadian response, calculated by sine wave fitting. </td> </tr> <tr> <th nowrap> Correlation </th> <td> The correlation coefficient of the fitted sine wave with the circadian oscillation. </td> </tr> <tr> <th> label:Expression X hours </th> <td> The gene expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_COL_LDHH.html#work_information'>DiurnalHours_ATTED_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_COL_SD.html#work_information'>DiurnalHours_ATTED_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_DD_DDHC.html#work_information'>DiurnalHours_ATTED_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHC.html#work_information'>DiurnalHours_ATTED_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHH_SM.html#work_information'>DiurnalHours_ATTED_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHH_ST.html#work_information'>DiurnalHours_ATTED_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LER_SD.html#work_information'>DiurnalHours_ATTED_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_znknOX.html#work_information'>DiurnalHours_ATTED_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL12_LDHH.html#work_information'>DiurnalHours_ATTED_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL23_LDHH.html#work_information'>DiurnalHours_ATTED_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LLHC.html#work_information'>DiurnalHours_ATTED_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL_LDHC.html#work_information'>DiurnalHours_ATTED_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL_LLHC.html#work_information'>DiurnalHours_ATTED_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_lhyox_SD.html#work_information'>DiurnalHours_ATTED_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_longday.html#work_information'>DiurnalHours_ATTED_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_lux_2_LDHH.html#work_information'>DiurnalHours_ATTED_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_phyB9_SD.html#work_information'>DiurnalHours_ATTED_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_shortday.html#work_information'>DiurnalHours_ATTED_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_ATTED_COL_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_COL_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_DD_DDHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LDHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LDHH_SM
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LDHH_ST
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LER_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LIGHT5_HIF138_13
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LIGHT5_HIF138_8
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LIGHT5_znknOX
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL12_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL23_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LLHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL_LDHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL_LLHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_lhyox_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_longday
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_lux_2_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_phyB9_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_shortday
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
Circadian Genomic (DIURNAL + PPDB promoter motif) Full
Contributor:GenoCon
Update:Jan 15, 2013
8894 Downloads, 29 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the LDSS motifs as calculated by PPDB. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> PPDB motif </th> <td> A link to the PPDB database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif type </th> <td> Type of the PPDB promoter motif. The identified octamers have been classified into regulatory element group (REG), TATA box, and Y Patch. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site (TSS). </td> </tr> <tr> <th nowrap> genome_version </th> <td> The genome version of annotated motifs. </td> </tr> <tr> <th nowrap> TAIR_gene </th> <td> Gene information associated with the motifs. </td> </tr> <tr> <th nowrap> chromosome </th> <td> Chromosome number the gene belongs. </td> </tr> <tr> <th nowrap> position start </th> <td> The absolute start position of the motif. </td> </tr> <tr> <th nowrap> position start from TSS peak </th> <td> The position of the motif start relative to the TSS peak. </td> </tr> <tr> <th nowrap> position end </th> <td> The absolute end position of the motif. </td> </tr> <tr> <th nowrap> position end from TSS peak </th> <td> The position of the motif end relative to the TSS peak. </td> </tr> <tr> <th nowrap> strand </th> <td> The strand of the feature. + for positive strand, - for minus strand. </td> </tr> <tr> <th nowrap> TSS peak position </th> <td> The absolute position of the TSS peak, which is the most probable TSS position determined by the CT-MPSS method. </td> </tr> <tr> <th> TSS peak position from Initial codon </th> <td> The position of the TSS peak relative to Initial codon. </td> </tr> <tr> <th nowrap> Initial codon </th> <td> The absolute position of the Initial codon. </td> </tr> <tr> <th nowrap> label:Expression X hours </th> <td> The gene expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_LDHH.html#work_information'>DiurnalHours_PPDB_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_SD.html#work_information'>DiurnalHours_PPDB_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_DD_DDHC.html#work_information'>DiurnalHours_PPDB_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHC.html#work_information'>DiurnalHours_PPDB_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_SM.html#work_information'>DiurnalHours_PPDB_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_ST.html#work_information'>DiurnalHours_PPDB_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LER_SD.html#work_information'>DiurnalHours_PPDB_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_znknOX.html#work_information'>DiurnalHours_PPDB_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL12_LDHH.html#work_information'>DiurnalHours_PPDB_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL23_LDHH.html#work_information'>DiurnalHours_PPDB_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LLHC.html#work_information'>DiurnalHours_PPDB_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LDHC.html#work_information'>DiurnalHours_PPDB_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LLHC.html#work_information'>DiurnalHours_PPDB_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lhyox_SD.html#work_information'>DiurnalHours_PPDB_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_longday.html#work_information'>DiurnalHours_PPDB_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lux_2_LDHH.html#work_information'>DiurnalHours_PPDB_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_phyB9_SD.html#work_information'>DiurnalHours_PPDB_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_shortday.html#work_information'>DiurnalHours_PPDB_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_PPDB_COL_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_COL_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_DD_DDHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LDHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LDHH_SM
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LDHH_ST
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LER_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LIGHT5_HIF138_13
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LIGHT5_HIF138_8
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LIGHT5_znknOX
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL12_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL23_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LLHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL_LDHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL_LLHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_lhyox_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_longday
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_lux_2_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_phyB9_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_shortday
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
ATTED promoter sequence
Contributor:Koro_Nishikata
Update:Jan 15, 2013
447 Downloads, 15 Applications
Baseline sequences associated with ATTED promoter motifs. <br><br> <strong>Reference</strong><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> baseline sequence</th> <td> the promoter sequence of the region -550 to -51 from the transcription start site (TSS)</td> </tr> <tr> <th nowrap>minimal promoter sequence </th> <td>the promoter sequence of the region -50 to -1 from the TSS</td> </tr> </table> <br> <br> --> <b> Descriptions for each table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s462i/ATTED_promoter_sequence.html#work_information'>ATTED_promoter_sequence</a><td> This is a baseline sequence associated with ATTED promoter motifs. </td> </tr> </table>
ATTED_promoter_sequence
[
atted_baseLineSequence
]
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Mar 6, 2013
5762 Downloads, 32 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Flowering.html#work_information'>AtGenExpress_ATTED_Flowering</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Fruit_Seeds.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Leaf.html#work_information'>AtGenExpress_ATTED_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Root.html#work_information'>AtGenExpress_ATTED_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Seedling.html#work_information'>AtGenExpress_ATTED_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Stem.html#work_information'>AtGenExpress_ATTED_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Whole_Plant.html#work_information'>AtGenExpress_ATTED_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> </table> . </td> </tr> </table>
AtGenExpress_ATTED_Flowering
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect,ManualInputMotif
]
AtGenExpress_ATTED_Fruit_Seeds
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect,ManualInputMotif
]
AtGenExpress_ATTED_Leaf
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect,ManualInputMotif
]
AtGenExpress_ATTED_Root
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect,ManualInputMotif
]
AtGenExpress_ATTED_Seedling
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect,ManualInputMotif
]
AtGenExpress_ATTED_Stem
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect,ManualInputMotif
]
AtGenExpress_ATTED_Whole_Plant
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect,ManualInputMotif
]
Heptamer_elements
PPDB_position
Speedup Lists of Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
1926 Downloads, 24 Applications
Lists for the AtGenExpress and ATTEDII mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by absolute expression level. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_top.html#work_information'>AtGenExpress_ATTED_top</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_bottom.html#work_information'>AtGenExpress_ATTED_bottom</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the bottom 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_all.html#work_information'>AtGenExpress_ATTED_all</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the all genes ranked by absolute expression level. </td> </tr> </table>
AtGenExpress_ATTED_all
AtGenExpress_ATTED_bottom
[
result_bottom
]
AtGenExpress_ATTED_top
[
result_top
]
Speedup Lists of Circadian Genomic (DIURNAL + PPDB promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
5060 Downloads, 23 Applications
Lists for the Diurnal and PPDB mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by circadian amplitude. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Expression X hours </th> <td> The genes ranked by absolute expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> <tr> <th nowrap> condition:Conditions_Range </th> <td> The genes ranked by absolute expression level under the given condition, and for the given circadian phase range. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_0to4_top.html#work_information'>DiurnalHours_PPDB_0to4_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 0 to 4 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_4to8_top.html#work_information'>DiurnalHours_PPDB_4to8_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 4 to 8 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_8to12_top.html#work_information'>DiurnalHours_PPDB_8to12_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 8 to 12 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_12to16_top.html#work_information'>DiurnalHours_PPDB_12to16_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 12 to 16 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_16to20_top.html#work_information'>DiurnalHours_PPDB_16to20_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 16 to 20 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_20to24_top.html#work_information'>DiurnalHours_PPDB_20to24_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 20 to 24 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_top.html#work_information'>DiurnalHours_PPDB_top</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_bottom.html#work_information'>DiurnalHours_PPDB_bottom</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the bottom 1000 genes ranked by circadian amplitude. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_all.html#work_information'>DiurnalHours_PPDB_all</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table>
DiurnalHours_PPDB_0to4_top
[
result_top
]
DiurnalHours_PPDB_12to16_top
[
result_top
]
DiurnalHours_PPDB_16to20_top
[
result_top
]
DiurnalHours_PPDB_20to24_top
[
result_top
]
DiurnalHours_PPDB_4to8_top
[
result_top
]
DiurnalHours_PPDB_8to12_top
[
result_top
]
DiurnalHours_PPDB_all
DiurnalHours_PPDB_bottom
[
result_bottom
]
DiurnalHours_PPDB_top
[
result_top
]
PPDB promoter sequence
Contributor:Koro_Nishikata
Update:Jan 17, 2013
366 Downloads, 15 Applications
Baseline sequences associated with PPDB promoter motifs. <br><br> <strong>Reference</strong><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> baseline sequence</th> <td> the promoter sequence of the region -550 to -51 from the transcription start site (TSS)</td> </tr> <tr> <th nowrap>minimal promoter sequence </th> <td>the promoter sequence of the region -50 to -1 from the TSS</td> </tr> </table> <br> <br> --> <b> Descriptions for each table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s463i/PPDB_promoter_sequence.html#work_information'>PPDB_promoter_sequence</a><td> This is a baseline sequence associated with PPDB promoter motifs. </td> </tr> </table>
PPDB_promoter_sequence
[
ppdb_baseLineSequence
]
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s302i?tab=readme
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
Work
Add
Clear
insert work id or work name.