Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
LocusSelect
useful
0
Loading...
LocusSelect = function(containerId, options) { new Application.highChart(containerId, options); }; if (Application === "undefined" || !Application) { var Application = {}; } Application.highChart = function() { this._init.apply(this, arguments); }; Application.highChart.prototype = { _containerId : null, _options : null, _workId : null, _fileName : null, _highChartContainerId : null, _appProperty : null, _default : { appName : "LocusSelect", filterNamespace : "http://linkdata.org/", subjectUriPhrase : "http://atted.jp/data/locus/", subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=", selectSubjectClass : "selectSubject", drawArea : "drawArea", loadingImageContainer : "loadingImageContainer", acceptPropLabelPrefix : "label:", loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif", databaseInfoClass : "databaseInfo", dbInfoLinkClass : "dbInfoLink", geneInfoLinkClass : "geneInfoLink", geneInfoAttedLinkClass : "geneInfoAttedLink", geneInfoPpdbLinkClass : "geneInfoPpdbLink", geneInfoEfpLinkClass : "geneInfoEfpLink", geneInfoHannaDbLinkClass : "geneInfoHannaDbLink", serverUrl : "http://linkdata.org/", yAxisLabel : "Gene Expression Level" }, _tooltipName : { selectProperty : "selectproperty", atted2 : "atted-ii", hanaDb : "hanadb", efp : "efp", ppdb : "ppdb", replace : "replace", manuallyInputMotif : "userinputmotif", locusSelect : "locusSelect" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._workId = this._options.workId; this._fileName = this._options.fileName; var date = new Date(); this._highChartContainerId = "high_chart_" + date.getTime(); this._initToolTip(); this._initAppProperty(this._options); this._initView(); }, _initToolTip : function() { var self = this; self._tooltip = (self._options.tooltip) ? self._options.tooltip : new Application.tooltip(); }, _initAppProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._appProperty = new Application.motifProperty(obj); }, _initView : function() { var self = this; var initView = function(subjectList) { var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Select Locus</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<select class='" + self._default.selectSubjectClass + "'>"; sb[sb.length] = "<option value='" + -1 + "'>-- Select Locus --</option>"; $.each(subjectList, function(subKey, subValue) { var label = self._getLabel(subValue); sb[sb.length] = "<option value='" + subValue + "'>" + label + "</option>"; }); sb[sb.length] = "</select>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>"; sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>"; sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>"; sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>"; sb[sb.length] = "</div>"; $("#" + self._containerId).html(sb.join("")); self._initSelect(); } LinkData.getSubjects(self._workId, self._fileName, initView); }, _initSelect : function() { var self = this; var timer = new Application.timer(); var initSelect = function() { $select = $("#" + self._containerId + " ." + self._default.selectSubjectClass); if ($select.length != 0) { $select.change(function() { $("#" + self._containerId + " ." + self._options.loadingImageContainer).show(); var subject = $("option:selected", this).val(); self._drawHighChart(subject); }); } else { timer.call(initSelect); } } initSelect(); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _drawHighChart : function(subject) { var self = this; var getDataArray = function(tripleList) { var dataArray = []; var dataObject = {}; var array = []; var duplicateProperty = []; $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { array.push(parseFloat(tValue.object)); duplicateProperty.push(property); } }); dataObject.name = self._getLabel(subject); dataObject.data = array; dataArray.push(dataObject); self._getXCategory(tripleList, dataArray); self._showDatabaseInfo(subject); } LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray); }, _getXCategory : function(tripleList, dataArray) { var self = this; var array = []; var duplicateProperty = []; $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { array.push(self._getDisplayLabel(label)); duplicateProperty.push(property); } }); self._drawChart(self._highChartContainerId, dataArray, array); $("#" + self._containerId + " ." + self._options.loadingImageContainer).hide(); }, _drawChart : function(containerId, dataArray, xCategory) { var self = this; var chart = new Highcharts.Chart({ chart: { renderTo: containerId, type: 'line', marginRight: 130, marginBottom: 125 }, title: { text: self._fileName }, xAxis: { categories: xCategory, labels : { rotation: 315 } }, yAxis: { title: { text: self._default.yAxisLabel } }, tooltip: { formatter: function() { return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']'; } }, legend: { layout: 'vertical', align: 'right', verticalAlign: 'top', x: -10, y: 100, borderWidth: 0 }, series: dataArray }); }, _showDatabaseInfo : function(subject) { var self = this, fileName = self._options.fileName, appName = self._options.appName; var gene = self._getLabel(subject); var dbInfoHtml = self._getDatabaseInfo(fileName, appName, gene); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); self._previewListener(subject, gene); }, _previewListener : function(subject, gene) { var self = this; self._dbPreviewListener(); self._genePreviewListener(subject); self._attedPreviewListener(subject); self._ppdbPreviewListener(gene); self._efpPreviewListener(gene); self._hannaDbPreviewListener(gene); }, _dbPreviewListener : function() { var self = this; var workId = self._options.workId, fileName = self._options.fileName; var url = self._options.serverUrl + "work/" + workId + "/" + fileName + ".html#work_information"; $("#" + self._containerId + " ." + self._options.dbInfoLinkClass).click(function() { self._showPopupWindow(url); }); }, _genePreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() { self._showPopupWindow(subject); }); }, _attedPreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoAttedLinkClass).click(function() { self._showPopupWindow(subject); }); }, _ppdbPreviewListener : function(gene) { var self = this; var url = "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene.toString().toUpperCase(); $("#" + self._containerId + " ." + self._options.geneInfoPpdbLinkClass).click(function() { self._showPopupWindow(url); }); }, _efpPreviewListener : function(gene) { var self = this; var url = "http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi?dataSource=Developmental_Map&modeInput=Absolute&primaryGene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoEfpLinkClass).click(function() { self._showPopupWindow(url); }); }, _hannaDbPreviewListener : function(gene) { var self = this; var url = "http://evolver.psc.riken.jp/seiken/GENE/" + gene.toUpperCase() + ".html"; $("#" + self._containerId + " ." + self._options.geneInfoHannaDbLinkClass).click(function() { self._showPopupWindow(url); }); }, _getDatabaseInfo : function(fileName, method, gene) { var self = this; var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Database</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<span title='" + self._tooltip.getByKey(fileName) + "'>" + fileName + "</span>"; sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.dbInfoLinkClass + "'>LinkData</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Tool</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(self._tooltipName.locusSelect) + "'>" + method + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Gene Locus</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<span>" + gene + "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif Analysis Links</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.atted2) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoAttedLinkClass + "'>ATTED-II</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.ppdb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoPpdbLinkClass + "'>PPDB</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Gene Expression Visualization Links</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.efp) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoEfpLinkClass + "'>eFP</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.hanaDb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoHannaDbLinkClass + "'>HanaDB</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; return sb.join(""); }, _showPopupWindow : function(url) { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2)); var winTop = parseInt((screen.availHeight/2) - (winHeight/2)); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }, _getLabel : function(value) { var self = this, label; if (value.indexOf("#") > -1) { label = self._getLabelAfterHash(value); } else { label = self._appProperty.getGeneBySubject(value); } if (!label) { label = value; } return label; }, _getPropertyLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); propLabel = this._appProperty.getPropertyNameByLabel(propLabel); } return propLabel; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.motifProperty = function() { this._init.apply(this, arguments); }; Application.motifProperty.prototype = { _options : null, _propMap : null, _nameMap : null, _optionArray : null, _default : { acceptPropLabelPrefix : "label:", subjectATTEDUriPhrase : "http://atted.jp/data/locus/", subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" }, _init : function(options) { this._options = $.extend({}, this._default, options); this._propMap = []; this._nameMap = []; this._initPropMap(this._options); }, _initPropMap : function(opts) { var self = this, workId = opts.workId, fileName = opts.fileName; var method = function(properties) { self._fillPropMap(self, properties); self._initOptionArray(properties); } LinkData.getProperties(workId, fileName, method); }, _fillPropMap : function(self, properties) { $.each(properties, function(key, value) { var label = self._getLabel(value); if (!self._propMap[label]) { self._propMap[label] = value; } }); }, _initOptionArray : function(propertyList) { var self = this, list = new Object(); var workId = self._options.workId, fileName = self._options.fileName; self._optionArray = []; $.each(propertyList, function(key, value) { var propLabel = self._getLabel(value); if (!self._ignore(propLabel)) { var obj = {}; obj.key = propLabel; obj.value = self._getDisplayLabel(propLabel); self._optionArray.push(obj); } }); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, getOptionArray : function() { return this._optionArray; }, getPropertyByLabel : function(label) { return this._propMap[label]; }, getGeneBySubject : function(subject) { var self = this, htmlExt = ".html", geneLabel; if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, ""); } else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, ""); } if (geneLabel && geneLabel.indexOf(htmlExt) > -1) { geneLabel = geneLabel.replace(htmlExt, ""); } return geneLabel; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 1000; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; }, setMaxRetryCount : function(no) { this._maxRetry = no; } }; Application.tooltip = function() { this._init.apply(this, arguments); }; Application.tooltip.prototype = { _toolTipList : null, _default : { explanationProperty : "explanation" }, _init : function() { this._toolTipList = []; this._initToolTip(); }, _initToolTip : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._getFilePropertyList(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, "tooltip", getFilesByTag); }, _getFilePropertyList : function(workId, fileName) { var self = this; var index = new Application.index(1, 10000); var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.explanationProperty) > -1) { self._getSubjectList(workId, fileName, pValue, index); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getSubjectList : function(workId, fileName, property, index) { var self = this; var getSubjects = function(subjectList) { self._getPropertyList(subjectList, workId, fileName, property, index); } LinkData.getSubjects(workId, fileName, getSubjects, index); }, _getPropertyList : function(subjectList, workId, fileName, property, index) { var self = this; var getTriplesByProperty = function(tripleList) { self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index); } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index); }, _addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) { var self = this; for (var i = 0; i < subjectList.length; i++) { var key = self._getLabelAfterHash(subjectList[i]); var value = tripleList[i].object; self._addToolTip(key, value); } if (subjectList && subjectList.length == index.getItemCount()) { self._getSubjectList(workId, fileName, property, index.increment()); } }, _addToolTip : function(key, tooltip) { var obj = {}; obj.key = key; obj.tooltip = tooltip; this._toolTipList.push(obj); }, getByKey : function(key) { var self = this, tooltip; $.each(self._toolTipList, function(objKey, obj) { if (obj.key === key) { tooltip = obj.tooltip; return false; } }); return (tooltip) ? tooltip : ""; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; $(document).ready(function(){ var fillDatabase = function(resultList) { $(".highChartDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>"); $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { $(".highChartDatabase").append("<option value='" + workId + "|" + fileName + "'>" + fileName + "</option>"); }); }); $(".highChartDatabase").change(function() { var dbKey = $("option:selected", $(this)).val(); if (dbKey == -1) { $("#container").html(""); return; } var array = dbKey.split("|"); var containerId = "container"; var options = { workId : array[0], fileName : array[1], baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" }; new Application.highChart(containerId, options); }); } LinkData.getFilesByTag(null, "database", fillDatabase); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 125px; } .row { padding: 5px 0; } .row:after { content: ""; clear: left; display: block; } .row input[type="text"] { width: 200px; } .row .externalLink { margin: 0 5px; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; }
<div class="row"> <div class="label left">Select Database</div> <div class="left"><select class="highChartDatabase"></select></div> </div> <div id="container"></div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
Circadian Genomic (DIURNAL + PPDB promoter motif) Full
Contributor:GenoCon
Update:Jan 15, 2013
9477 Downloads, 29 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the LDSS motifs as calculated by PPDB. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> PPDB motif </th> <td> A link to the PPDB database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif type </th> <td> Type of the PPDB promoter motif. The identified octamers have been classified into regulatory element group (REG), TATA box, and Y Patch. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site (TSS). </td> </tr> <tr> <th nowrap> genome_version </th> <td> The genome version of annotated motifs. </td> </tr> <tr> <th nowrap> TAIR_gene </th> <td> Gene information associated with the motifs. </td> </tr> <tr> <th nowrap> chromosome </th> <td> Chromosome number the gene belongs. </td> </tr> <tr> <th nowrap> position start </th> <td> The absolute start position of the motif. </td> </tr> <tr> <th nowrap> position start from TSS peak </th> <td> The position of the motif start relative to the TSS peak. </td> </tr> <tr> <th nowrap> position end </th> <td> The absolute end position of the motif. </td> </tr> <tr> <th nowrap> position end from TSS peak </th> <td> The position of the motif end relative to the TSS peak. </td> </tr> <tr> <th nowrap> strand </th> <td> The strand of the feature. + for positive strand, - for minus strand. </td> </tr> <tr> <th nowrap> TSS peak position </th> <td> The absolute position of the TSS peak, which is the most probable TSS position determined by the CT-MPSS method. </td> </tr> <tr> <th> TSS peak position from Initial codon </th> <td> The position of the TSS peak relative to Initial codon. </td> </tr> <tr> <th nowrap> Initial codon </th> <td> The absolute position of the Initial codon. </td> </tr> <tr> <th nowrap> label:Expression X hours </th> <td> The gene expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_LDHH.html#work_information'>DiurnalHours_PPDB_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_SD.html#work_information'>DiurnalHours_PPDB_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_DD_DDHC.html#work_information'>DiurnalHours_PPDB_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHC.html#work_information'>DiurnalHours_PPDB_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_SM.html#work_information'>DiurnalHours_PPDB_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_ST.html#work_information'>DiurnalHours_PPDB_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LER_SD.html#work_information'>DiurnalHours_PPDB_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_znknOX.html#work_information'>DiurnalHours_PPDB_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL12_LDHH.html#work_information'>DiurnalHours_PPDB_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL23_LDHH.html#work_information'>DiurnalHours_PPDB_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LLHC.html#work_information'>DiurnalHours_PPDB_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LDHC.html#work_information'>DiurnalHours_PPDB_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LLHC.html#work_information'>DiurnalHours_PPDB_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lhyox_SD.html#work_information'>DiurnalHours_PPDB_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_longday.html#work_information'>DiurnalHours_PPDB_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lux_2_LDHH.html#work_information'>DiurnalHours_PPDB_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_phyB9_SD.html#work_information'>DiurnalHours_PPDB_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_shortday.html#work_information'>DiurnalHours_PPDB_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_PPDB_COL_LDHH
DiurnalHours_PPDB_COL_SD
DiurnalHours_PPDB_DD_DDHC
DiurnalHours_PPDB_LDHC
DiurnalHours_PPDB_LDHH_SM
DiurnalHours_PPDB_LDHH_ST
DiurnalHours_PPDB_LER_SD
DiurnalHours_PPDB_LIGHT5_HIF138_13
DiurnalHours_PPDB_LIGHT5_HIF138_8
DiurnalHours_PPDB_LIGHT5_znknOX
DiurnalHours_PPDB_LL12_LDHH
DiurnalHours_PPDB_LL23_LDHH
DiurnalHours_PPDB_LLHC
DiurnalHours_PPDB_LL_LDHC
DiurnalHours_PPDB_LL_LLHC
DiurnalHours_PPDB_lhyox_SD
DiurnalHours_PPDB_longday
DiurnalHours_PPDB_lux_2_LDHH
DiurnalHours_PPDB_phyB9_SD
DiurnalHours_PPDB_shortday
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Mar 6, 2013
5940 Downloads, 32 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Flowering.html#work_information'>AtGenExpress_ATTED_Flowering</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Fruit_Seeds.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Leaf.html#work_information'>AtGenExpress_ATTED_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Root.html#work_information'>AtGenExpress_ATTED_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Seedling.html#work_information'>AtGenExpress_ATTED_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Stem.html#work_information'>AtGenExpress_ATTED_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Whole_Plant.html#work_information'>AtGenExpress_ATTED_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> </table> . </td> </tr> </table>
AtGenExpress_ATTED_Flowering
[
database
]
AtGenExpress_ATTED_Fruit_Seeds
AtGenExpress_ATTED_Leaf
AtGenExpress_ATTED_Root
AtGenExpress_ATTED_Seedling
AtGenExpress_ATTED_Stem
AtGenExpress_ATTED_Whole_Plant
Heptamer_elements
PPDB_position
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s258i?tab=readme
Initial content
jquery-1.7.1.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
Work
Add
Clear
insert work id or work name.