Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
PromoterCAD Beginning Tutorial 1 - example application
useful
0
Loading...
if (typeof Application == "undefined" || !Application) { var Application = {}; } Application.genocon = function() { this._init.apply(this, arguments); }; Application.genocon.prototype = { CHAR_SEQ_EMPTY : "-", _baseSequence : null, _tooltip : null, _methodList : null, _appBaseLineSequence : null, _default : { baseSequenceContainerId : "baseSequenceContainer", fixedSequenceClass : "fixedSequence", finishSequence : "finishSequence", baseErrorMessageClass : "baseErrorMessage", errorMessageEnterSequence : "Please enter a sequence of minimum length {0}", errorMessageMaximumSequence : "Please enter a sequence of maximum length {0}", useButtonClass : "useButton", nextButtonClass : "nextButton", finishNowButtonClass : "finishNow", nextButtonContainerClass : "nextButtonContainer", collapseButton : "collapseButton", expandButton : "expandButton", removeButton : "removeButton", appContainerClass : "applicationContainer", appDataContainerClass : "applicationDataContainer", actionButtonContainer : "actionButtonContainer", actionResultContainer : "actionResultContainer", baseSequenceBoxClass : "baseSequenceBox", baseSequenceClass : "baseSequence", selectDataBaseList : "databaseList", selectMethodList : "optionList", databaseFilteringProperty : "#motif%20sequence", methodUrlProperty : "#application%20URL", baseSequenceMinLength : 50, baseSequenceMaxLength : 500, applicationOptionClass : "applicationOptionRadio" }, _tag : { databaseTag : "database", methodTag : "method" }, _tooltipName : { atGeneExpress : "atgenexpress", diurnal : "diurnal", selectDatabase : "selectdatabase", selectTool : "selecttool", motifExpress : "motifexpress", motifCircatian : "motifcircadian", motifRank : "motifrank", motifQuery : "motifquery", defaultSequence : "basesequence", fixedSequence : "gacccttcctctatataaggaagttcatttcatttggagaggacctcgac", finishNow : "finishnow", next : "next", start : "start", }, _init : function() { this._methodList = []; this._initToolTip(); this._initDefaultSequence(); this._initAppBaseLineSequence(); this._initLoadScript(); this._initUseButtonListener(); }, _initToolTip : function() { this._tooltip = new Application.tooltip(); }, _initDefaultSequence : function() { var self = this, sb = []; for (var i = 0; i < self._default.baseSequenceMaxLength; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } $baseInput = $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceClass); $baseInput.val(sb.join("")); $baseInput.keyup(function() { var size = ($baseInput.val().length != 0) ? $baseInput.val().length : 1; $baseInput.attr("size", size); }); $("#" + this._default.baseSequenceContainerId + " ." + this._default.baseSequenceBoxClass).scrollLeft(10000); var timer = new Application.timer(); var applyToolTip = function() { var dToolTip = self._getToolTip(self._tooltipName.defaultSequence); var fToolTip = self._getToolTip(self._tooltipName.fixedSequence); if (dToolTip && fToolTip) { $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("title", dToolTip); $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass).attr("title", fToolTip); } else { timer.call(applyToolTip); } } applyToolTip(); }, _initAppBaseLineSequence : function() { this._appBaseLineSequence = new Application.baseLineSequence(); }, _initLoadScript : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var getProperties = function(propertytList) { $.each(propertytList, function(propKey, propVal) { if (propVal.indexOf(self._default.methodUrlProperty) > -1) { self._loadPluginScriptList(workId, fileName, propVal); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); return false; }); }); } LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag); }, _initDefaultContainer : function() { this._initDatabase(); this._initMethod(); this._initActionButton(); this._initDatabaseListener(); this._initMethodListener(); }, _initDatabase : function() { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList); $select.attr("title", self._getToolTip(self._tooltipName.selectDatabase)); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Database --</option>"); var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var dbKey = self._getDatabaseOptionKey(workId, fileName); var tooltip = self._tooltip.getByKey(fileName); $select.append("<option value='" + dbKey + "' title='" + tooltip + "'>" + fileName + "</option>"); }); }); } LinkData.getFilesByTag("", self._tag.databaseTag, getFilesByTag); }, _initMethod : function() { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Tool --</option>"); $select.attr("title", self._getToolTip(self._tooltipName.selectTool)); var getFilesByTag = function(result) { $.each(result, function(workId, fileArray){ $.each(fileArray, function(fileKey, fileName) { var getSubjects = function(subjectList) { $.each(subjectList, function(subKey, subVal) { var label = self._getLabel(subVal); var tooltip = self._getToolTipByToolName(label); tooltip = (tooltip) ? tooltip : ""; $select.append("<option value='" + label + "' title='" + tooltip + "'>" + label + "</option>"); self._methodList.push(label); }); } LinkData.getSubjects(workId, fileName, getSubjects); }); }); } LinkData.getFilesByTag(null, self._tag.methodTag, getFilesByTag); }, _initActionButton : function() { var self = this; $("." + self._default.actionButtonContainer + " ." + self._default.collapseButton).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.appDataContainerClass).hide(); }); $("." + self._default.actionButtonContainer + " ." + self._default.expandButton).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.appDataContainerClass).show(); }); $("." + self._default.actionButtonContainer + " ." + self._default.removeButton).click(function() { $(this).closest("." + self._default.appContainerClass).remove(); }); }, _initDatabaseListener : function() { var self = this; var $selectDb = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList); $selectDb.change(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.applicationOptionClass).hide(); $(parent).find("." + self._default.selectMethodList + " option").removeAttr("selected"); $(parent).find("." + self._default.nextButtonContainerClass).hide(); $container = $(parent).find("." + self._default.actionResultContainer); $container.html(""); var dbKey = $("option:selected", $(this)).val(); self._changeMethodList(dbKey); }); }, _initMethodListener : function() { var self = this; var $selectDb = $("." + self._default.appContainerClass + " ." + self._default.selectDataBaseList); var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $select.change(function() { var parent = $(this).closest("." + self._default.appContainerClass); var method = $("option:selected", $(this)).text(); var database = $("option:selected", $(parent).find("." + self._default.selectDataBaseList)).val(); if (database == -1) { return; } $container = $(parent).find("." + self._default.actionResultContainer); $container.html("Loading..."); $(parent).find("." + self._default.applicationOptionClass).hide(); $(parent).find("." + self._default.nextButtonContainerClass).hide(); var date = new Date(); var id = "container_id_" + date.getTime(); $container.attr("id", id); var func = function() { self._callback(parent, self); } var arr = database.split("|"); var obj = { workId : arr[0], fileName : arr[1], baseSequence : self._baseSequence, tooltip : self._tooltip, callback : func }; if (method === "MotifExpress") { $(parent).find("." + self._default.applicationOptionClass).show(); var appOption = $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption]:checked").val(); if (!appOption) { appOption = "max"; $(parent).find("." + self._default.applicationOptionClass + " input[name=applicationOption][value='max']").attr("checked", true); } obj.applicationOption = appOption; $(parent).find("." + self._default.applicationOptionClass).unbind('click'); $(parent).find("." + self._default.applicationOptionClass).click(function() { $(parent).find("." + self._default.nextButtonContainerClass).hide(); $("#" + id).html(""); obj.applicationOption = $(this).find("input[name=applicationOption]:checked").val(); eval(method)(id, obj); }); } eval(method)(id, obj); }); }, _loadPluginScriptList : function(workId, fileName, property) { var getTripleList = function(tripleList) { $.each(tripleList, function(tKey, tVal) { LinkDataUtil.loadScript(tVal.object); }); } LinkData.getTriplesByProperty(workId, fileName, property, getTripleList); }, _changeMethodList : function(dbKey) { var self = this; var $select = $("." + self._default.appContainerClass + " ." + self._default.selectMethodList); $select.attr("title", self._getToolTip(self._tooltipName.selectTool)); $("option", $select).remove(); $select.append("<option value='-1' selected='selected'>-- Select Tool --</option>"); if (dbKey == -1) { return; } var arr = dbKey.split("|"); var workId = arr[0]; var fileName = arr[1]; $.each(self._methodList, function(key, method) { self._addValidMethod($select, workId, fileName, method); }); }, _addValidMethod : function($select, workId, fileName, method) { var self = this; var getFilesByTag = function(fileList) { if (!fileList) { return; } $.each(fileList, function(fKey, fName) { if (fName === fileName) { var tooltip = self._getToolTipByToolName(method); tooltip = (tooltip) ? tooltip : ""; $select.append("<option value='" + method + "' title='" + tooltip + "'>" + method + "</option>"); return false; } }); } LinkData.getFilesByTag(workId, method, getFilesByTag); }, _initUseButtonListener : function() { var self = this; $("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).click(function() { self._initDefaultContainer(); $txtSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass); $fixedSeq = $("#" + self._default.baseSequenceContainerId + " ." + self._default.fixedSequenceClass); self._hideError(); if ($txtSeq.val().length > self._default.baseSequenceMaxLength) { self._showError(self._default.errorMessageMaximumSequence.replace("{0}", self._default.baseSequenceMaxLength)); return; } if ($txtSeq.val().length < self._default.baseSequenceMaxLength) { var tmpVal = $txtSeq.val(); var eVal = self._getExtraDefaultSequence(self._default.baseSequenceMaxLength - $txtSeq.val().length); $txtSeq.val(eVal + tmpVal); $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseSequenceClass).attr("size", 500); } self._baseSequence = $txtSeq.val() + $fixedSeq.html(); if (!self._baseSequence || self._baseSequence.length < self._default.baseSequenceMinLength) { self._showError(self._default.errorMessageEnterSequence.replace("{0}", self._default.baseSequenceMinLength)); } else { $txtSeq.attr('readonly', true).addClass("noborder"); $(this).hide(); $("." + self._default.appContainerClass).show(); } }); var timer = new Application.timer(); var applyStartButToolTip = function() { var toolTip = self._getToolTip(self._tooltipName.start); if (toolTip) { $("#" + self._default.baseSequenceContainerId + " ." + self._default.useButtonClass).attr("title", toolTip); } else { timer.call(applyStartButToolTip); } } applyStartButToolTip(); }, _callback : function(parent, self) { $(parent).find("." + self._default.nextButtonContainerClass).show(); $(parent).find("." + self._default.finishSequence).hide(); $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).attr("title", self._getToolTip(self._tooltipName.next)); $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).attr("title", self._getToolTip(self._tooltipName.finishNow)); self._initNextButtonListener(); self._initFinishNowButtonListener(); }, _initNextButtonListener : function() { var self = this; $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).unbind('click'); $("." + self._default.appContainerClass + " ." + self._default.nextButtonClass).click(function() { $parent = $(this).closest("." + self._default.appContainerClass); $parent.find("." + self._default.nextButtonContainerClass).hide(); $(parent).find("." + self._default.finishSequence).hide() var clone = $parent.clone(true); $(clone).find("." + self._default.applicationOptionClass).hide(); var text = $(clone).find(".replaceSequence").text(); if (text && text.trim().length != 0) { self._baseSequence = text; } $(clone).find("." + self._default.actionResultContainer).html(""); $(clone).find("." + self._default.nextButtonContainerClass).hide(); $parent.parent().append(clone); }); }, _initFinishNowButtonListener : function() { var self = this; $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).unbind('click'); $("." + self._default.appContainerClass + " ." + self._default.finishNowButtonClass).click(function() { var parent = $(this).closest("." + self._default.appContainerClass); $(parent).find("." + self._default.nextButtonContainerClass).hide(); $(parent).find("." + self._default.finishSequence).hide() var gene = $(parent).find(".replaceSequence .gene").val(); var geneType = $(parent).find(".replaceSequence .geneType").val(); var callback = function(bSequence) { self._showFinishedBaseSequence(parent, bSequence); } self._appBaseLineSequence.getBaseSequence(gene, geneType, callback); }); }, _showFinishedBaseSequence : function(parent, bSequence) { var self = this; var defaultSequence = $(parent).find(".replaceSequence").text() var html = self._getFinishedBaseSequence(defaultSequence, bSequence); $(parent).find("." + self._default.finishSequence).show() $(parent).find("." + self._default.finishSequence).html(html); $(parent).find("." + self._default.finishSequence).scrollLeft(10000); }, _getFinishedBaseSequence : function(defaultSequence, bSequence) { var self = this, sb = []; for (var i = 0; i < defaultSequence.length; i++) { var dChar = defaultSequence.charAt(i); var bChar = bSequence.charAt(i); if (bChar) { if (dChar !== self.CHAR_SEQ_EMPTY) { sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>"; } else { sb[sb.length] = bChar; } } else { sb[sb.length] = "<span class='highlight-sequence'><span class='replace'>" + dChar + "</span></span>"; } } return sb.join(""); }, _getExtraDefaultSequence : function(count) { var self = this, sb = []; for (var i = 0; i < count; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } return sb.join(""); }, _getDatabaseOptionKey : function(workId, fileName) { return workId + "|" + fileName; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _showError : function(message) { var self = this; $errMsgEl = $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass); $errMsgEl.html(message); $errMsgEl.show(); }, _hideError : function() { var self = this; $("#" + self._default.baseSequenceContainerId + " ." + self._default.baseErrorMessageClass).hide(); }, _getToolTipByFileName : function(fileName) { var self = this; if (fileName) { if (fileName.toLowerCase().indexOf(self._tooltipName.atGeneExpress) > -1) { return self._getToolTip(self._tooltipName.atGeneExpress); } else if (fileName.toLowerCase().indexOf(self._tooltipName.diunal) > -1) { return self._getToolTip(self._tooltipName.diunal); } } }, _getToolTipByToolName : function(tool) { var self = this; if (tool) { if (tool.toLowerCase().indexOf(self._tooltipName.motifExpress) > -1) { return self._getToolTip(self._tooltipName.motifExpress); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifCircatian) > -1) { return self._getToolTip(self._tooltipName.motifCircatian); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifRank) > -1) { return self._getToolTip(self._tooltipName.motifRank); } else if (tool.toLowerCase().indexOf(self._tooltipName.motifQuery) > -1) { return self._getToolTip(self._tooltipName.motifQuery); } } }, _getToolTip : function(key) { return this._tooltip.getByKey(key); } }; Application.baseLineSequence = function() { this._init.apply(this, arguments); }; Application.baseLineSequence.prototype = { _attedSequenceInfo : null, _ppdbSequenceInfo : null, _default : { sequenceProperty : "sequence" }, _tag : { attedBaseSequenceTag : "atted_baseLineSequence", ppdbBaseSequenceTag : "ppdb_baseLineSequence" }, _init : function() { this._attedSequenceInfo = {}; this._ppdbSequenceInfo = {}; this._initBaseSequenceFile(); }, _initBaseSequenceFile : function() { this._initAttedBaseSequenceFile(); this._initPpdbBaseSequenceFile(); }, _initAttedBaseSequenceFile : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initAttedInfo(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._tag.attedBaseSequenceTag, getFilesByTag); }, _initPpdbBaseSequenceFile : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initPpdbInfo(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._tag.ppdbBaseSequenceTag, getFilesByTag); }, _initAttedInfo : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.sequenceProperty) > -1) { self._attedSequenceInfo.workId = workId; self._attedSequenceInfo.fileName = fileName; self._attedSequenceInfo.property = pValue; return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _initPpdbInfo : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.sequenceProperty) > -1) { self._ppdbSequenceInfo.workId = workId; self._ppdbSequenceInfo.fileName = fileName; self._ppdbSequenceInfo.property = pValue; return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getAttedSubjectUrl : function(gene) { return "http://atted.jp/data/locus/" + gene + ".html"; }, _getPpdbSubjectUrl : function(gene) { return "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene; }, _getAttedBaseSequence : function(gene, callback) { var self = this; var workId = self._attedSequenceInfo.workId; var fileName = self._attedSequenceInfo.fileName; var property = self._attedSequenceInfo.property; var subject = self._getAttedSubjectUrl(gene); var getObjects = function(objList) { callback(objList[0]); } LinkData.getObjects(workId, fileName, subject, property, getObjects); }, _getPpdbBaseSequence : function(gene, callback) { var self = this; var workId = self._ppdbSequenceInfo.workId; var fileName = self._ppdbSequenceInfo.fileName; var property = self._ppdbSequenceInfo.property; var subject = self._getPpdbSubjectUrl(gene); var getObjects = function(objList) { callback(objList[0]); } LinkData.getObjects(workId, fileName, subject, property, getObjects); }, getBaseSequence : function(gene, geneType, callback) { var self = this; if ("ATTED" === geneType) { self._getAttedBaseSequence(gene, callback); } else if ("PPDB" === geneType) { self._getPpdbBaseSequence(gene, callback); } else { // error } } }; Application.tooltip = function() { this._init.apply(this, arguments); }; Application.tooltip.prototype = { _toolTipList : null, _default : { explanationProperty : "explanation" }, _init : function() { this._toolTipList = []; this._initToolTip(); }, _initToolTip : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._getFilePropertyList(workId, fileName); }); }); } LinkData.getFilesByTag(null, "tooltip", getFilesByTag); }, _getFilePropertyList : function(workId, fileName) { var self = this; var index = new Application.index(1, 10000); var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.explanationProperty) > -1) { self._getSubjectList(workId, fileName, pValue, index); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getSubjectList : function(workId, fileName, property, index) { var self = this; var getSubjects = function(subjectList) { self._getPropertyList(subjectList, workId, fileName, property, index); } LinkData.getSubjects(workId, fileName, getSubjects, index); }, _getPropertyList : function(subjectList, workId, fileName, property, index) { var self = this; var getTriplesByProperty = function(tripleList) { self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index); } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index); }, _addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) { var self = this; //if (!tripleList) { //return; //} for (var i = 0; i < subjectList.length; i++) { //if (tripleList[i]) { var key = self._getLabelAfterHash(subjectList[i]); var value = tripleList[i].object; self._addToolTip(key, value); //} } if (subjectList && subjectList.length == index.getItemCount()) { self._getSubjectList(workId, fileName, property, index.increment()); } }, _addToolTip : function(key, tooltip) { var obj = {}; obj.key = key; obj.tooltip = tooltip; this._toolTipList.push(obj); }, getByKey : function(key) { var self = this, tooltip; $.each(self._toolTipList, function(objKey, obj) { if (obj.key === key) { tooltip = obj.tooltip; return false; } }); return (tooltip) ? tooltip : ""; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.index = function() { this._init.apply(this, arguments); } Application.index.prototype = { _start : null, _end : null, _init : function(start, end) { this._start = start; this._end = end; }, getIndex : function() { return {start : this._start, end : this._end}; }, getItemCount : function() { return (this._end - this._start + 1); }, increment : function() { var itemCount = this.getItemCount(); this._start = this._start + itemCount; this._end = this._end + itemCount; return {start : this._start, end : this._end}; }, getStartIndex : function() { return this._start; }, getEndIndex : function() { return this._end; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 100; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; } }; $(document).ready(function() { new Application.genocon(); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } #gcAppContainer { width: 900px; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 125px; } input.baseSequence { /*width: 100%;*/ } .highlight-sequence { font-weight: bold; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; white-space: nowrap; } .resultArea .userSequence { white-space: nowrap; } .finishSequence, .replaceSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; overflow: auto; white-space: nowrap; } .replace { color: #E80010; } .baseErrorMessage, .errorMessage { color: #FF0000; text-align: center; } .applicationContainer { background-color: #F6F6F6; border: 1px solid #CCCCCC; margin: 5px 0 0; padding: 5px; } .actionButtonContainer { text-align: right; } .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .row { padding: 5px 0; } .row:after { clear: left; content: ""; display: block; } .row input[type="text"] { width: 200px; } .row .externalLink { margin: 0 5px; } .noborder { border: medium none; } #baseSequenceContainer .baseSequenceBox { width: 100%; overflow: auto; white-space: nowrap; } #baseSequenceContainer .baseSequenceBox span, #baseSequenceContainer .baseSequenceBox .baseSequence { font-family: Courier; } #baseSequenceContainer .baseSequenceBox .fixedSequence { position: relative; left: -6px; color: #AAAAAA; font-weight: bold; } .applicationContainer .nextButtonContainer { margin-top: 10px; } .databaseInfo .motif { width: 70%; } /** * button css */ a.useButton { width: 80px; } .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; } .loadingImageContainer .loadingMessage { color: #FF0000; } .motifConflictionDialog .option { margin: 10px; }
<div id="gcAppContainer"> <div id="baseSequenceContainer"> <div class="label">Base Sequence</div> <div class="baseSequenceBox"> <span> <input type="text" class="baseSequence" size="500" value=""/> </span> <span class="fixedSequence">GACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC</span> </div> <div style="margin-top:5px;"><a class="useButton btn btn-green">Start</a></div> <div class="baseErrorMessage hidden"></div> </div> <div class="applicationContainer hidden"> <div class="actionButtonContainer"> <span class="appSummery"></span> <span class="collapseButton actionBtn" title="collapse">_</span> <span class="expandButton actionBtn" title="expand">+</span> <span class="removeButton actionBtn" title="remove">x</span> <br clear="all"/> </div> <div class="applicationDataContainer"> <div class="row"> <div class="label left">Select Database</div> <div class="left"><select class="databaseList"></select></div> </div> <div class="row"> <div class="label left">Select Tool</div> <div class="left"> <select class="optionList"></select> <span class="applicationOptionRadio hidden"> <input type="radio" name="applicationOption" value="max" checked="checked"/> Max <input type="radio" name="applicationOption" value="min"/> Min </span> </div> </div> <div class="actionResultContainer"></div> <div class="nextButtonContainer hidden"> <a class="btn nextButton">Next</a> <a class="btn finishNow">Finish Now</a> </div> <div class="finishSequence hidden"></div> </div> </div> </div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Jan 15, 2013
9003 Downloads, 27 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the CEG motifs as calculated by ATTED-II. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style="text-align:left;"> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site. </td> </tr> <tr> <th nowrap> motif </th> <td> A link to the database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> CEG </th> <td> The Coexpression Expression Group score as calculated by ATTED-II. </td> </tr> <tr> <th nowrap> Probe Condition </th> <td> The strain and growth condition of the 44 hour experiment. </td> </tr> <tr> <th nowrap> Phase </th> <td> The phase of circadian response, calculated by sine wave fitting. </td> </tr> <tr> <th nowrap> Correlation </th> <td> The correlation coefficient of the fitted sine wave with the circadian oscillation. </td> </tr> <tr> <th> label:Expression X hours </th> <td> The gene expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_COL_LDHH.html#work_information'>DiurnalHours_ATTED_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_COL_SD.html#work_information'>DiurnalHours_ATTED_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_DD_DDHC.html#work_information'>DiurnalHours_ATTED_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHC.html#work_information'>DiurnalHours_ATTED_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHH_SM.html#work_information'>DiurnalHours_ATTED_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHH_ST.html#work_information'>DiurnalHours_ATTED_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LER_SD.html#work_information'>DiurnalHours_ATTED_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_znknOX.html#work_information'>DiurnalHours_ATTED_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL12_LDHH.html#work_information'>DiurnalHours_ATTED_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL23_LDHH.html#work_information'>DiurnalHours_ATTED_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LLHC.html#work_information'>DiurnalHours_ATTED_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL_LDHC.html#work_information'>DiurnalHours_ATTED_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL_LLHC.html#work_information'>DiurnalHours_ATTED_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_lhyox_SD.html#work_information'>DiurnalHours_ATTED_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_longday.html#work_information'>DiurnalHours_ATTED_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_lux_2_LDHH.html#work_information'>DiurnalHours_ATTED_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_phyB9_SD.html#work_information'>DiurnalHours_ATTED_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_shortday.html#work_information'>DiurnalHours_ATTED_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_ATTED_COL_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_COL_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_DD_DDHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LDHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LDHH_SM
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LDHH_ST
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LER_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LIGHT5_HIF138_13
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LIGHT5_HIF138_8
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LIGHT5_znknOX
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL12_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL23_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LLHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL_LDHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_LL_LLHC
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_lhyox_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_longday
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_lux_2_LDHH
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_phyB9_SD
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_ATTED_shortday
[
DiurnalHours,ATTED,database,MotifExpress,LocusSelect,MotifCircadian
]
Circadian Genomic (DIURNAL + PPDB promoter motif) Full
Contributor:GenoCon
Update:Jan 15, 2013
8608 Downloads, 29 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the LDSS motifs as calculated by PPDB. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> PPDB motif </th> <td> A link to the PPDB database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif type </th> <td> Type of the PPDB promoter motif. The identified octamers have been classified into regulatory element group (REG), TATA box, and Y Patch. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site (TSS). </td> </tr> <tr> <th nowrap> genome_version </th> <td> The genome version of annotated motifs. </td> </tr> <tr> <th nowrap> TAIR_gene </th> <td> Gene information associated with the motifs. </td> </tr> <tr> <th nowrap> chromosome </th> <td> Chromosome number the gene belongs. </td> </tr> <tr> <th nowrap> position start </th> <td> The absolute start position of the motif. </td> </tr> <tr> <th nowrap> position start from TSS peak </th> <td> The position of the motif start relative to the TSS peak. </td> </tr> <tr> <th nowrap> position end </th> <td> The absolute end position of the motif. </td> </tr> <tr> <th nowrap> position end from TSS peak </th> <td> The position of the motif end relative to the TSS peak. </td> </tr> <tr> <th nowrap> strand </th> <td> The strand of the feature. + for positive strand, - for minus strand. </td> </tr> <tr> <th nowrap> TSS peak position </th> <td> The absolute position of the TSS peak, which is the most probable TSS position determined by the CT-MPSS method. </td> </tr> <tr> <th> TSS peak position from Initial codon </th> <td> The position of the TSS peak relative to Initial codon. </td> </tr> <tr> <th nowrap> Initial codon </th> <td> The absolute position of the Initial codon. </td> </tr> <tr> <th nowrap> label:Expression X hours </th> <td> The gene expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_LDHH.html#work_information'>DiurnalHours_PPDB_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_SD.html#work_information'>DiurnalHours_PPDB_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_DD_DDHC.html#work_information'>DiurnalHours_PPDB_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHC.html#work_information'>DiurnalHours_PPDB_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_SM.html#work_information'>DiurnalHours_PPDB_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_ST.html#work_information'>DiurnalHours_PPDB_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LER_SD.html#work_information'>DiurnalHours_PPDB_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_znknOX.html#work_information'>DiurnalHours_PPDB_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL12_LDHH.html#work_information'>DiurnalHours_PPDB_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL23_LDHH.html#work_information'>DiurnalHours_PPDB_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LLHC.html#work_information'>DiurnalHours_PPDB_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LDHC.html#work_information'>DiurnalHours_PPDB_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LLHC.html#work_information'>DiurnalHours_PPDB_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lhyox_SD.html#work_information'>DiurnalHours_PPDB_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_longday.html#work_information'>DiurnalHours_PPDB_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lux_2_LDHH.html#work_information'>DiurnalHours_PPDB_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_phyB9_SD.html#work_information'>DiurnalHours_PPDB_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_shortday.html#work_information'>DiurnalHours_PPDB_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_PPDB_COL_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_COL_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_DD_DDHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LDHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LDHH_SM
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LDHH_ST
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LER_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LIGHT5_HIF138_13
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LIGHT5_HIF138_8
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LIGHT5_znknOX
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL12_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL23_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LLHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL_LDHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_LL_LLHC
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_lhyox_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_longday
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_lux_2_LDHH
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_phyB9_SD
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
DiurnalHours_PPDB_shortday
[
DiurnalHours,PPDB,database,MotifExpress,LocusSelect,MotifCircadian
]
Speedup Lists of Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
3290 Downloads, 19 Applications
Lists for the Diurnal and ATTED-II mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by circadian amplitude. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Expression X hours </th> <td> The genes ranked by absolute expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> <tr> <th nowrap> condition:Conditions_Range </th> <td> The genes ranked by absolute expression level under the given condition, and for the given circadian phase range. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_0to4_top.html#work_information'>DiurnalHours_ATTED_0to4_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 0 to 4 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_4to8_top.html#work_information'>DiurnalHours_ATTED_4to8_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 4 to 8 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_8to12_top.html#work_information'>DiurnalHours_ATTED_8to12_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 8 to 12 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_12to16_top.html#work_information'>DiurnalHours_ATTED_12to16_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 12 to 16 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_16to20_top.html#work_information'>DiurnalHours_ATTED_16to20_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 16 to 20 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_20to24_top.html#work_information'>DiurnalHours_ATTED_20to24_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 20 to 24 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_top.html#work_information'>DiurnalHours_ATTED_top</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by circadian amplitude. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_bottom.html#work_information'>DiurnalHours_ATTED_bottom</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the bottom 1000 genes ranked by circadian amplitude. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s342i/DiurnalHours_ATTED_all.html#work_information'>DiurnalHours_ATTED_all</a> </td> <td> Lists for the DIURNAL and ATTED-II mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table>
DiurnalHours_ATTED_0to4_top
[
result_top
]
DiurnalHours_ATTED_12to16_top
[
result_top
]
DiurnalHours_ATTED_16to20_top
[
result_top
]
DiurnalHours_ATTED_20to24_top
[
result_top
]
DiurnalHours_ATTED_4to8_top
[
result_top
]
DiurnalHours_ATTED_8to12_top
[
result_top
]
DiurnalHours_ATTED_all
DiurnalHours_ATTED_bottom
[
result_bottom
]
DiurnalHours_ATTED_top
[
result_top
]
ATTED promoter sequence
Contributor:Koro_Nishikata
Update:Jan 15, 2013
439 Downloads, 15 Applications
Baseline sequences associated with ATTED promoter motifs. <br><br> <strong>Reference</strong><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> baseline sequence</th> <td> the promoter sequence of the region -550 to -51 from the transcription start site (TSS)</td> </tr> <tr> <th nowrap>minimal promoter sequence </th> <td>the promoter sequence of the region -50 to -1 from the TSS</td> </tr> </table> <br> <br> --> <b> Descriptions for each table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s462i/ATTED_promoter_sequence.html#work_information'>ATTED_promoter_sequence</a><td> This is a baseline sequence associated with ATTED promoter motifs. </td> </tr> </table>
ATTED_promoter_sequence
[
atted_baseLineSequence
]
PromoterCAD Beginning Tutorial 1 - Tooltip Information
Contributor:Koro_Nishikata
Update:Jan 11, 2013
929 Downloads, 2 Applications
tooltip_AtGenExpress
[
tooltip
]
tooltip_DataTable
[
tooltip
]
tooltip_PromoterCAD_menus_buttons
[
tooltip
]
Application Plugins for Synthetic Promoter Design
Contributor:GenoCon
Update:Feb 8, 2013
590 Downloads, 6 Applications
Application_Plugins_for_Synthetic_Promoter_Design
[
method
]
Application_Plugins_for_Synthetic_Promoter_Design_Copy_1
[
]
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Mar 6, 2013
5647 Downloads, 32 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Flowering.html#work_information'>AtGenExpress_ATTED_Flowering</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Fruit_Seeds.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Leaf.html#work_information'>AtGenExpress_ATTED_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Root.html#work_information'>AtGenExpress_ATTED_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Seedling.html#work_information'>AtGenExpress_ATTED_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Stem.html#work_information'>AtGenExpress_ATTED_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Whole_Plant.html#work_information'>AtGenExpress_ATTED_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> </table> . </td> </tr> </table>
AtGenExpress_ATTED_Flowering
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect
]
AtGenExpress_ATTED_Fruit_Seeds
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect
]
AtGenExpress_ATTED_Leaf
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect
]
AtGenExpress_ATTED_Root
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect
]
AtGenExpress_ATTED_Seedling
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect
]
AtGenExpress_ATTED_Stem
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect
]
AtGenExpress_ATTED_Whole_Plant
[
AtGenExpress,ATTED,database,MotifExpress,LocusSelect
]
Heptamer_elements
[
heptamer
]
PPDB_position
Speedup Lists of Developmental Genomic (AtGenExpress + PPDB promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
2069 Downloads, 21 Applications
Lists for the AtGenExpress and PPDB mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by absolute expression level. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s341i/AtGenExpress_PPDB_top.html#work_information'>AtGenExpress_PPDB_top</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s341i/AtGenExpress_PPDB_bottom.html#work_information'>AtGenExpress_PPDB_bottom</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the bottom 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s341i/AtGenExpress_PPDB_all.html#work_information'>AtGenExpress_PPDB_all</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by absolute expression level. </td> </tr> </table>
AtGenExpress_PPDB_all
AtGenExpress_PPDB_bottom
[
result_bottom
]
AtGenExpress_PPDB_top
[
result_top
]
Speedup Lists of Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
1865 Downloads, 24 Applications
Lists for the AtGenExpress and ATTEDII mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by absolute expression level. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_top.html#work_information'>AtGenExpress_ATTED_top</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_bottom.html#work_information'>AtGenExpress_ATTED_bottom</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the bottom 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_all.html#work_information'>AtGenExpress_ATTED_all</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the all genes ranked by absolute expression level. </td> </tr> </table>
AtGenExpress_ATTED_all
AtGenExpress_ATTED_bottom
[
result_bottom
]
AtGenExpress_ATTED_top
[
result_top
]
Speedup Lists of Circadian Genomic (DIURNAL + PPDB promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
4830 Downloads, 23 Applications
Lists for the Diurnal and PPDB mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by circadian amplitude. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Expression X hours </th> <td> The genes ranked by absolute expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> <tr> <th nowrap> condition:Conditions_Range </th> <td> The genes ranked by absolute expression level under the given condition, and for the given circadian phase range. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_0to4_top.html#work_information'>DiurnalHours_PPDB_0to4_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 0 to 4 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_4to8_top.html#work_information'>DiurnalHours_PPDB_4to8_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 4 to 8 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_8to12_top.html#work_information'>DiurnalHours_PPDB_8to12_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 8 to 12 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_12to16_top.html#work_information'>DiurnalHours_PPDB_12to16_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 12 to 16 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_16to20_top.html#work_information'>DiurnalHours_PPDB_16to20_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 16 to 20 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_20to24_top.html#work_information'>DiurnalHours_PPDB_20to24_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 20 to 24 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_top.html#work_information'>DiurnalHours_PPDB_top</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_bottom.html#work_information'>DiurnalHours_PPDB_bottom</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the bottom 1000 genes ranked by circadian amplitude. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_all.html#work_information'>DiurnalHours_PPDB_all</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table>
DiurnalHours_PPDB_0to4_top
[
result_top
]
DiurnalHours_PPDB_12to16_top
[
result_top
]
DiurnalHours_PPDB_16to20_top
[
result_top
]
DiurnalHours_PPDB_20to24_top
[
result_top
]
DiurnalHours_PPDB_4to8_top
[
result_top
]
DiurnalHours_PPDB_8to12_top
[
result_top
]
DiurnalHours_PPDB_all
DiurnalHours_PPDB_bottom
[
result_bottom
]
DiurnalHours_PPDB_top
[
result_top
]
PPDB promoter sequence
Contributor:Koro_Nishikata
Update:Jan 17, 2013
347 Downloads, 15 Applications
Baseline sequences associated with PPDB promoter motifs. <br><br> <strong>Reference</strong><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> baseline sequence</th> <td> the promoter sequence of the region -550 to -51 from the transcription start site (TSS)</td> </tr> <tr> <th nowrap>minimal promoter sequence </th> <td>the promoter sequence of the region -50 to -1 from the TSS</td> </tr> </table> <br> <br> --> <b> Descriptions for each table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s463i/PPDB_promoter_sequence.html#work_information'>PPDB_promoter_sequence</a><td> This is a baseline sequence associated with PPDB promoter motifs. </td> </tr> </table>
PPDB_promoter_sequence
[
ppdb_baseLineSequence
]
Developmental Genomic (AtGenExpress + PPDB promoter motif) Full
Contributor:GenoCon
Update:Jan 22, 2013
4645 Downloads, 27 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). For each motif, we calculated the position relative to the TSS as determined experimentally (PPDB). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> PPDB motif </th> <td> A link to the PPDB database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif type </th> <td> Type of the PPDB promoter motif. The identified octamers have been classified into regulatory element group (REG), TATA box, and Y Patch. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site (TSS). </td> </tr> <tr> <th nowrap> genome_version </th> <td> The genome version of annotated motifs. </td> </tr> <tr> <th nowrap> TAIR_gene </th> <td> Gene information associated with the motifs. </td> </tr> <tr> <th nowrap> chromosome </th> <td> Chromosome number the gene belongs. </td> </tr> <tr> <th nowrap> position start </th> <td> The absolute start position of the motif. </td> </tr> <tr> <th nowrap> position start from TSS peak </th> <td> The position of the motif start relative to the TSS peak. </td> </tr> <tr> <th nowrap> position end </th> <td> The absolute end position of the motif. </td> </tr> <tr> <th nowrap> position end from TSS peak </th> <td> The position of the motif end relative to the TSS peak. </td> </tr> <tr> <th nowrap> strand </th> <td> The strand of the feature. + for positive strand, - for minus strand. </td> </tr> <tr> <th nowrap> TSS peak position </th> <td> The absolute position of the TSS peak, which is the most probable TSS position determined by the CT-MPSS method. </td> </tr> <tr> <th> TSS peak position from Initial codon </th> <td> The position of the TSS peak relative to Initial codon. </td> </tr> <tr> <th nowrap> Initial codon </th> <td> The absolute position of the Initial codon. </td> </tr> <tr> <th nowrap> label:Conditions </th> <td> The gene expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Flowering.html#work_information'>AtGenExpress_PPDB_Flowering</a> </td> <td> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Fruit_Seeds.html#work_information'>AtGenExpress_PPDB_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Leaf.html#work_information'>AtGenExpress_PPDB_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Root.html#work_information'>AtGenExpress_PPDB_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Seedling.html#work_information'>AtGenExpress_PPDB_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Stem.html#work_information'>AtGenExpress_PPDB_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Whole_Plant.html#work_information'>AtGenExpress_PPDB_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/Octamer_elements.html#work_information'>Octamer_elements</a> </td> <td> A list of the 8mer sequence motifs from PPDB. This table lists each 8mer along with the appropriate median position from the TSS, calculated from all 8mers. </td> </tr> </table>
AtGenExpress_PPDB_Flowering
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Fruit_Seeds
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Leaf
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Root
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Seedling
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Stem
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
AtGenExpress_PPDB_Whole_Plant
[
AtGenExpress,PPDB,database,MotifExpress,LocusSelect
]
Octamer_elements
[
octamer
]
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s173i?tab=readme
Initial content
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
Work
Add
Clear
insert work id or work name.