Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
MotifMinCircadian
useful
0
Loading...
MotifMinCircadian = function(containerId, options) { new Application.motifMaxCircadian(containerId, options); }; if (Application === "undefined" || !Application) { var Application = {}; } Application.motifMaxCircadian = function() { this._init.apply(this, arguments); }; Application.motifMaxCircadian.prototype = { _containerId : null, _baseSequence : null, _options : null, _tooltip : null, _motifProperty : null, _heptamer : null, _octamer : null, _appSequence : null, _motifViewDialogId : null, _addAnotherMotifDialogId : null, _motifConflictConfirmDialogId : null, _geneInfoContainerId : null, _default : { appName : "MotifMinCircadian", selectRangeCaption : "Select Range", selectPropertyAreaClass : "selectPropertyArea", selectPropertyClass : "selectProperty", resultAreaClass : "resultArea", replaceButtonAreaClass : "replaceButtonArea", replaceButtonClass : "replaceButton", nextButtonAreaClass : "nextButtonArea", replaceSequenceClass : "replaceSequence", errorMessageAreaClass : "errorMessage", dialogErrorMessageClass : "dialogErrorMessage", dialogOutRangeValueMessage : "Please input a value between {0} and {1}", noSequenceForThisRange : "No sequence found for this range", invalidDatabase : "Invalid database. Please select valid database.", databaseInfoClass : "databaseInfo", addAnotherMotifButtonClass : "addAnotherMotifButton", geneLabelClass : "geneUrl", dbInfoLinkClass : "dbInfoLink", geneInfoLinkClass : "geneInfoLink", geneInfoAttedLinkClass : "geneInfoAttedLink", geneInfoPpdbLinkClass : "geneInfoPpdbLink", geneInfoEfpLinkClass : "geneInfoEfpLink", geneInfoHannaDbLinkClass : "geneInfoHannaDbLink", motifSequenceProperty : "motif sequence", motifPositionProperty : "motif position", sinePhaseProperty : "Sine Phase", sineAmplitudeProperty : "Sine Amplitude", typeProperty : "type", validType : "REG", motifViewDialogId : "motifViewDialog", motifViewDialogClass : "motifViewDialog", motifViewDialogTitle : "Motif View", conflictionDialogTitle : "Confliction", minSequenceClass : "minSeq", maxSequenceClass : "maxSeq", websiteNameAtted : "ATTED", websiteNamePpdb : "PPDB", geneTypeAtted : "ATTED", geneTypePpdb : "PPDB", baseSequenceMinLength : 50, dialogImageUrl : "http://app.linkdata.org/asset/a06f4de4.png", callback : function() {}, loadingImageContainer : "loadingImageContainer", loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif", loadingMessageClass : "loadingMessage", loadingMessage : "Loading linked data, it may take a few minutes...", serverUrl : "http://linkdata.org/" }, _tag : { topResult : "result_top" }, _tooltipName : { selectRange : "selectrange", atted2 : "atted-ii", hanaDb : "hanadb", efp : "efp", ppdb : "ppdb", replace : "replace", manuallyInputMotif : "userinputmotif", motifExpress : "motifexpress", motifCircatian : "motifcircadian", }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._baseSequence = this._options.baseSequence; var date = new Date(); this._geneInfoContainerId = "gene_info_containerId_" + date.getTime(); this._initToolTip(); this._initMotifProperty(this._options); this._initAppSequence(this._options); this._initHeptamer(); this._initOctamer(); this._initView(); this._initDialog(); }, _initToolTip : function() { var self = this; self._tooltip = (self._options.tooltip) ? self._options.tooltip : new Application.tooltip(); }, _initMotifProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._motifProperty = new Application.motifProperty(obj); }, _initAppSequence : function(opts) { var self = this; var timer = new Application.timer(); var init = function() { var seqProperty = self._motifProperty.getPropertyByLabel(self._options.motifSequenceProperty); var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); if (seqProperty && posProperty) { var obj = { workId : opts.workId, fileName : opts.fileName, baseSequence : self._baseSequence, motifSequenceProperty : seqProperty, motifPositionProperty : posProperty, containerId : self._containerId, errorMessageClass : self._options.errorMessageAreaClass, baseSequenceMinLength : self._options.baseSequenceMinLength }; self._appSequence = new Application.sequence(obj); } else { timer.call(init); } } init(); }, _initHeptamer : function() { this._heptamer = new Application.heptamer(); }, _initOctamer : function() { this._octamer = new Application.octamer(); }, _initView : function() { this._initMainView(); this._initDialogView(); this._initAddAnotherMotifDialogView(); this._initConflictConfirmDialogView(); }, _initDialog : function() { this._initMotifViewDialog(); this._initAddAnotherMotifDialog(); this._initMotifConflictConfirmDialog(); }, _initMainView : function() { var self = this; var timer = new Application.timer(); var fillOptionMethod = function() { var optionArray = self._motifProperty.getOptionArray(); if (optionArray) { var sb = []; sb[sb.length] = "<div class='" + self._options.selectPropertyAreaClass + " row'>"; sb[sb.length] = "<div class='label left'>" + self._options.selectRangeCaption + "</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<select class='" + self._options.selectPropertyClass + "' title='" + self._tooltip.getByKey(self._tooltipName.selectRange) + "'>"; sb[sb.length] = "<option value='-1'>-- Select Range --</option>"; sb[sb.length] = "<option value='0-4'>0 to 4</option>"; sb[sb.length] = "<option value='4-8'>4 to 8</option>"; sb[sb.length] = "<option value='8-12'>8 to 12</option>"; sb[sb.length] = "<option value='12-16'>12 to 16</option>"; sb[sb.length] = "<option value='16-20'>16 to 20</option>"; sb[sb.length] = "<option value='20-24'>20 to 24</option>"; sb[sb.length] = "</select>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>"; sb[sb.length] = "<div id='" + self._geneInfoContainerId + "'></div>"; sb[sb.length] = "<div class='" + self._options.resultAreaClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.errorMessageAreaClass + " hidden'>error</div>"; sb[sb.length] = "<div class='" + self._options.replaceButtonAreaClass + " hidden'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.replace) + "' class='" + self._options.replaceButtonClass + " btn btn-lightblue'>Add Motifs</a> "; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.manuallyInputMotif) + "' class='" + self._options.addAnotherMotifButtonClass + " btn btn-lightblue'>Manually Input Motif</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.replaceSequenceClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>"; sb[sb.length] = "<div class='" + self._options.loadingMessageClass + "'>" + self._options.loadingMessage + "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + self._containerId).html(sb.join("")); self._initListener(); } else { timer.call(fillOptionMethod); } } fillOptionMethod(); }, _initDialogView : function() { var sb = [], self = this, date = new Date(); this._motifViewDialogId = "motifViewDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Replace with prefer position between "; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; //sb[sb.length] = "<div class='motifImageArea'>"; //sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; //sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Click "; //sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initAddAnotherMotifDialogView : function() { var sb = [], self = this, date = new Date(); this._addAnotherMotifDialogId = "addAnotherMotifDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + this._addAnotherMotifDialogId + "' class='hidden'>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Motif Sequence</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherSequence'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Position(-550 to -50)</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherPosition'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initConflictConfirmDialogView : function() { var sb = [], self = this, date = new Date(); self._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + self._motifConflictConfirmDialogId + "' class='hidden'>"; sb[sb.length] = "<div>New motif overlaps with old one. Which one should be kept in overalp regions?</div>"; sb[sb.length] = "<div class='option'>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='new'/> New</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='old'/> Old</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='discard'/> Discard new motif</label></div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<label><input type='checkbox' class='motifReplaceApplyToAll' value='applytoall'/> Apply to all</label>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initListener : function() { var self = this; self._initSelectPropertyListener(); self._initAddAnotherMotifButtonListener(); }, _initSelectPropertyListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var timer = new Application.timer(); var setSelectListener = function() { if ($("#" + self._containerId + " ." + self._options.selectPropertyClass).length != 0) { $("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() { $("#" + self._containerId + " ." + self._options.loadingImageContainer).show(); self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); $("#" + self._containerId + " #" + self._geneInfoContainerId).hide(); var range = $("option:selected", this).val(); if (range && range != -1) { self._showMotifMaxCircadian(workId, fileName, range); } }); } else { timer.call(setSelectListener); } } setSelectListener(); }, _initAddAnotherMotifButtonListener : function() { var self = this; $("#" + self._containerId + " ." + self._options.addAnotherMotifButtonClass).click(function() { self._appSequence.hideError(); $("#" + self._addAnotherMotifDialogId + " .anotherSequence").val(""); $("#" + self._addAnotherMotifDialogId + " .anotherPosition").val(""); $("#" + self._addAnotherMotifDialogId).dialog("open"); }); }, _showGenePlot : function(subject) { var self = this; $("#" + self._containerId + " #" + self._geneInfoContainerId).show(); var options = { workId : self._options.workId, fileName : self._options.fileName, subject : subject, property : "" }; new Application.geneChart(self._geneInfoContainerId, options); }, _showDataBaseInformationList : function() { var self = this, seqVal = []; $("#" + self._containerId + " .userSequence .hdnSequence").each(function() { var tmpPos = $(this).siblings(".hdnPosition").val(); seqVal.push($(this).val() + "[" + tmpPos + "]"); }); self._showDatabaseInfo(seqVal.join(", ")); }, _initReplaceButtonLitener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; $("#" + self._containerId + " ." + self._options.replaceButtonClass).unbind("click"); $("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() { var seqs = [], nonConflictSeqs = [], seqArray = [], posArray = [], conflictArray = []; $("#" + self._containerId + " .userSequence").each(function() { seqs.push($(this).text()); var seq = $(this).find(".hdnSequence").val(); var pos = $(this).find(".hdnPosition").val(); seqArray.push(seq); posArray.push(pos); if (self._hasConfliction(seq, pos)) { conflictArray.push(seq + "|" + pos); } else { nonConflictSeqs.push($(this).text()); } }); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); if (conflictArray.length > 0) { self._doReplace(nonConflictSeqs, seqArray, posArray); self._handleConfliction(conflictArray); } else { self._doReplace(seqs, seqArray, posArray); } }); }, _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { $("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var container = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); var pos = $(parent).find(".hdnPosition").val(); var seqEl = self._getSeqElBySeq(seq); var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; self._initSequencePopup(seqEl); $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide(); $("#" + self._motifViewDialogId + " .sequence").val(seq); $("#" + self._motifViewDialogId + " .position").val(appropriatePos); $("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq)); $("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq)); self._initPositionInsert(seq, appropriatePos); $("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); $("#" + self._motifViewDialogId).dialog("open"); $("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); }, _initSequencePopup : function(seqEl) { var self = this; $("#" + self._motifViewDialogId + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; $("#" + self._motifViewDialogId + " .moreInfo").click(function() { self._showPopupWindow(url); }); }, _hasConfliction : function(seq, pos, oldSequence) { var self = this; if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var array = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(array); for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); if (nChar !== "-" && oChar !== "-" && nChar !== oChar) { return true; } } return false; }, _handleConfliction : function(conflictArray) { var self = this; if (conflictArray.length > 0) { var arr = conflictArray[0].split("|"); var bArray = self._getConflictConfirmDialogButtonArray(conflictArray); var dialogTitle = self._options.conflictionDialogTitle + " - " + arr[0] + "[" + arr[1] + "]"; $("#" + self._motifConflictConfirmDialogId).find("input[name='motifReplaceOption'][value='new']").attr("checked", "checked"); $("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); $("#" + self._motifConflictConfirmDialogId).dialog({title : dialogTitle}); $("#" + self._motifConflictConfirmDialogId).dialog({buttons : bArray}); $("#" + self._motifConflictConfirmDialogId).dialog("open"); } }, _replaceWithOption : function(option, isApplyToAll, conflictArray) { var self = this; if (isApplyToAll) { self._replaceAllWithOption(option, conflictArray); } else { var value = conflictArray.splice(0, 1); var arr = value[0].split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); self._handleConfliction(conflictArray); } }, _replaceAllWithOption : function(option, conflictArray) { var self = this, html = oldSequence; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } $.each(conflictArray, function(key, conflict) { var arr = conflict.split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); }); }, _replaceSequenceByOption : function(option, seq, pos) { var self = this; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var seqArray = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(seqArray); var html = oldSequence; if (option === "new") { html = self._appSequence.getHtmlByReplacingNewSequence(oldSequence, newSequence); } else if (option === "old") { html = self._appSequence.getHtmlByReplacingOldSequence(oldSequence, newSequence); } self._doReplaceWithHtml(html); }, _getConflictConfirmDialogButtonArray : function(conflictArray) { var self = this; return [ { text: "Done", click : function() { $(this).dialog("close"); var option = $(this).find("input[name='motifReplaceOption']:checked").val(); var isApplyToAll = $(this).find(".motifReplaceApplyToAll").is(":checked"); self._replaceWithOption(option, isApplyToAll, conflictArray); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ]; }, _doReplace : function(seqs, seqArray, posArray) { var self = this; var html = self._appSequence.replace(seqs, seqArray, posArray); self._doReplaceWithHtml(html); }, _doReplaceWithHtml : function(html) { var self = this, sb = []; var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var gene = self._motifProperty.getGeneBySubject(subject); var geneType = self._getGeneType(); sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).scrollLeft(10000); self._showDataBaseInformationList(); self._options.callback(); }, _addAnotherMotif : function(seq, pos) { var self = this, conflictArray = []; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } if (self._hasConfliction(seq, pos, oldSequence)) { conflictArray.push(seq + "|" + pos); } if (conflictArray.length > 0) { self._handleConfliction(conflictArray); } else { self._replaceSequenceByOption("new", seq, pos); } }, _showPopupWindow : function(url) { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2)); var winTop = parseInt((screen.availHeight/2) - (winHeight/2)); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }, _initPositionInsert : function(seq, pos) { var self = this; var mod = seq.length % 2; $("#" + self._motifViewDialogId + " .position").unbind("keyup"); $("#" + self._motifViewDialogId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(val); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); }, _initMotifViewDialog : function() { var self = this; $("#" + self._motifViewDialogId).dialog({ autoOpen: false, title: self._default.motifViewDialogTitle, width: 520, dialogClass : self._options.motifViewDialogClass, buttons : [ { text: "Replace", click : function() { var seq = $("#" + self._motifViewDialogId).find(".sequence").val(); var pos = $("#" + self._motifViewDialogId).find(".position").val(); var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val()); var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val()); var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html()); var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html()); if (minPos > pos || maxPos < pos) { $dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass); $dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); $dialogError.show(); return; } self._replaceWithSequence(seq, pos, extraCopies, basePairs); $(this).dialog("close"); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, _initAddAnotherMotifDialog : function() { var self = this; $("#" + self._addAnotherMotifDialogId).dialog({ autoOpen: false, title: "Input Motif", buttons : [ { text: "Add", click : function() { var seq = $(this).find(".anotherSequence").val(); var pos = Math.abs($(this).find(".anotherPosition").val()); if (seq && pos) { self._addAnotherMotif(seq, pos); $(this).dialog("close"); } } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, _initMotifConflictConfirmDialog : function() { var self = this; $("#" + self._motifConflictConfirmDialogId).dialog({ autoOpen: false, width: 420, dialogClass : "motifConflictionDialog" }); }, _getMotifMaxCircadianTriple : function(workId, fileName, range) { var self = this; var property = self._motifProperty.getPropertyByLabel(self._options.sinePhaseProperty); var amplitudeProperty = self._motifProperty.getPropertyByLabel(self._options.sineAmplitudeProperty); if (!property) { $("#" + self._containerId + " ." + self._options.loadingImageContainer).hide(); self._appSequence._showError(self._options.invalidDatabase); return; } var index = new Application.index(1, 5000); var maxCircadianTriple; var getSinePhasePropertyList = function(sinePhaseTripleList) { var getSineAmplitudePropertyList = function(amplitudeTripleList) { var tmpMaxCircadianTriple = self._getMaxCircadianTriple(range, sinePhaseTripleList, amplitudeTripleList); if (tmpMaxCircadianTriple) { if (!maxCircadianTriple) { maxCircadianTriple = tmpMaxCircadianTriple; } var tmpMaxValue = parseFloat(maxCircadianTriple.object); var currentValue = parseFloat(tmpMaxCircadianTriple.object); if (Math.max(tmpMaxValue, currentValue) != tmpMaxValue) { maxCircadianTriple = tmpMaxCircadianTriple; } } if (sinePhaseTripleList && sinePhaseTripleList.length == index.getItemCount()) { LinkData.getTriplesByProperty(workId, fileName, property, getSinePhasePropertyList, index.increment()); } else { self._motifMaxCircadianSequence(workId, fileName, maxCircadianTriple.subject); } } LinkData.getTriplesByProperty(workId, fileName, amplitudeProperty, getSineAmplitudePropertyList, index.getIndex()); } LinkData.getTriplesByProperty(workId, fileName, property, getSinePhasePropertyList, index.getIndex()); }, _showMotifMaxCircadian : function(workId, fileName, range) { var self = this; var arr = range.split("-"); var rangePhrase = "_" + arr[0] + "to" + arr[1]; var fileSuffix = rangePhrase + "_top"; var foundTopFile = false; var getFilesByTag = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fKey, fName) { var tmpName = fName.split(fileSuffix); if (fileName.indexOf(tmpName[0]) > -1) { var propLabel = fileName.split(tmpName[0] + "_")[1] + rangePhrase; self._getTopFilePropertyList(workId, fileName, wId, fName, propLabel); foundTopFile = true; return false; } }); if (foundTopFile) { return false; } }); if (!foundTopFile) { self._getMotifMaxCircadianTriple(workId, fileName, range); } } LinkData.getFilesByTag(null, self._tag.topResult, getFilesByTag); }, _getTopFilePropertyList : function(workId, fileName, topWorkId, topFileName, propLabel) { var self = this; var getProperties = function(propList) { $.each(propList, function(propKey, propValue) { var tmpProp = self._motifProperty._getLabel(propValue); if (tmpProp.indexOf(propLabel) > -1) { self._showMaxCircadian(workId, fileName, topWorkId, topFileName, propValue); return false; } }); } LinkData.getProperties(topWorkId, topFileName, getProperties); }, _showMaxCircadian : function(workId, fileName, topWorkId, topFileName, topProperty) { var self = this; var index = new Application.index(1, 1000); var getTriplesByProperty = function(tripleList) { self._showMotifMaxCircadianByTripleList(workId, fileName, tripleList); } LinkData.getTriplesByProperty(topWorkId, topFileName, topProperty, getTriplesByProperty, index.getIndex()); }, _showMotifMaxCircadianByTripleList : function(workId, fileName, tripleList) { var self = this, i = 0, subject = tripleList[i].object; var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); var showMaxCircadianMotif = function(posTripleList) { var found = false; i++; $.each(posTripleList, function(pKey, pValue) { var tmpPos = parseInt(pValue); if (self._options.baseSequenceMinLength < tmpPos && self._options.baseSequence.length >= tmpPos) { found = true; self._motifMaxCircadianSequence(workId, fileName, subject); return false; } }); if (! found) { subject = tripleList[i].object; LinkData.getObjects(workId, fileName, subject, posProperty, showMaxCircadianMotif); } } LinkData.getObjects(workId, fileName, subject, posProperty, showMaxCircadianMotif); }, _getMaxCircadianTriple : function(range, sinePhaseTripleList, amplitudeTripleList) { var self = this, arr = range.split("-"); var startValue = parseFloat(arr[0]), endValue = parseFloat(arr[1]); var maxIndex = -1, maxValue = -99999; $.each (sinePhaseTripleList, function(tKey, tValue) { var tmpVal = parseFloat(tValue.object); if (tmpVal != endValue && Math.max(tmpVal, startValue) == tmpVal && Math.min(tmpVal, endValue) == tmpVal) { $.each (amplitudeTripleList, function(aKey, aValue) { if (tValue.subject == aValue.subject) { var amplitude = parseFloat(aValue.object); if (Math.max(maxValue, amplitude) != maxValue) { maxValue = amplitude; maxIndex = aKey; } } }); } }); if (maxIndex != -1) { return amplitudeTripleList[maxIndex]; } }, _getDataBaseWebsiteName : function() { var self = this; var fileName = self._options.fileName if (fileName.indexOf(self._options.websiteNameAtted) > -1) { return self._options.websiteNameAtted; } else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) { return self._options.websiteNamePpdb; } else { return "UNKNOWN"; } }, _getGeneType : function() { var self = this, fileName = self._options.fileName; if (fileName.indexOf(self._options.geneTypeAtted) > -1) { return self._options.geneTypeAtted; } else if (fileName.indexOf(self._options.geneTypePpdb) > -1) { return self._options.geneTypePpdb; } else { return "UNKNOWN"; } }, _motifMaxCircadianSequence : function(workId, fileName, subject) { var self = this; var drawSequence = function(seqHtml) { var sb = []; sb[sb.length] = "<input type='hidden' class='" + self._default.geneLabelClass + "' value='" + subject + "'/>"; sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>"; sb[sb.length] = seqHtml; $("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join("")); if (seqHtml.length == 0) { $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } self._initMotifSequenceListener(); self._initReplaceButtonLitener(); self._showDataBaseInformationList(); self._showGenePlot(subject); $("#" + self._containerId + " ." + self._options.resultAreaClass).show(); $("#" + self._containerId + " ." + self._options.resultAreaClass).scrollLeft(10000); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show(); $("#" + self._containerId + " ." + self._options.loadingImageContainer).hide(); } self._appSequence.getSequenceHtml(subject, drawSequence); }, _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 1 : 0.5; return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; }, _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; }, _getSeqElBySeq : function(seq) { if (seq && seq.trim().length == 7) { return this._heptamer.getBySequence(seq); } else if (seq && seq.trim().length == 8) { return this._octamer.getBySequence(seq); } }, _showDatabaseInfo : function(seqVal) { var self = this, workId = self._options.workId, fileName = self._options.fileName, appName = self._options.appName; var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val(); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var label = self._motifProperty._getDisplayLabel(propLabel); label = (label && label.trim().length != 0) ? label : propLabel; var usedMotif = (seqVal.length != 0) ? seqVal : "-"; var dbInfoHtml = self._getDatabaseInfo(workId, fileName, appName, subject, label, usedMotif); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); self._previewListener(subject); }, _previewListener : function(subject) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); self._dbPreviewListener(); self._genePreviewListener(subject); self._attedPreviewListener(subject); self._ppdbPreviewListener(gene); self._efpPreviewListener(gene); self._hannaDbPreviewListener(gene); }, _dbPreviewListener : function() { var self = this; var workId = self._options.workId, fileName = self._options.fileName; var url = self._options.serverUrl + "work/" + workId + "/" + fileName + ".html#work_information"; $("#" + self._containerId + " ." + self._options.dbInfoLinkClass).click(function() { self._showPopupWindow(url); }); }, _genePreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() { self._showPopupWindow(subject); }); }, _attedPreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoAttedLinkClass).click(function() { self._showPopupWindow(subject); }); }, _ppdbPreviewListener : function(gene) { var self = this; var url = "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoPpdbLinkClass).click(function() { self._showPopupWindow(url); }); }, _efpPreviewListener : function(gene) { var self = this; var url = "http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi?dataSource=Developmental_Map&modeInput=Absolute&primaryGene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoEfpLinkClass).click(function() { self._showPopupWindow(url); }); }, _hannaDbPreviewListener : function(gene) { var self = this; var url = "http://evolver.psc.riken.jp/seiken/GENE/" + gene.toUpperCase() + ".html"; $("#" + self._containerId + " ." + self._options.geneInfoHannaDbLinkClass).click(function() { self._showPopupWindow(url); }); }, _getDatabaseInfo : function(workId, fileName, method, subject, property, motif) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Database</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<span title='" + self._tooltip.getByKey(fileName) + "'>" + fileName + "</span>"; sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.dbInfoLinkClass + "'>LinkData</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Tool</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(self._tooltipName.motifCircatian) + "'>" + method + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Gene Locus</div>"; sb[sb.length] = "<div class='left'>"; //sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.geneInfoLinkClass + "'>" + gene + "</a>"; sb[sb.length] = "<span>" + gene + "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Data and Visualization Links</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.atted2) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoAttedLinkClass + "'>ATTED-II</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.ppdb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoPpdbLinkClass + "'>PPDB</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.efp) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoEfpLinkClass + "'>eFP</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.hanaDb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoHannaDbLinkClass + "'>HanaDB</a>"; sb[sb.length] = "</div>";; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Range</div>"; sb[sb.length] = "<div class='left'>" + property + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif</div>"; sb[sb.length] = "<div class='left motif'>" + motif + "</div>"; sb[sb.length] = "</div>"; return sb.join(""); }, _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this, sb = []; var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var gene = self._motifProperty.getGeneBySubject(subject); var geneType = self._getGeneType(); sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).scrollLeft(10000); var seqLabel = seq + "[" + pos + "]"; self._showDatabaseInfo(seqLabel); self._options.callback(); } }; Application.geneChart = function() { this._init.apply(this, arguments); }; Application.geneChart.prototype = { _containerId : null, _options : null, _workId : null, _fileName : null, _subject : null, _property : null, _highChartContainerId : null, _appProperty : null, _default : { filterNamespace : "http://linkdata.org/", acceptPropLabelPrefix : "label:" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._workId = this._options.workId; this._fileName = this._options.fileName; this._subject = this._options.subject; this._property = this._options.property; var date = new Date(); this._highChartContainerId = "gene_chart_" + date.getTime(); this._initAppProperty(this._options); this._initView(); this._drawHighChart(this._subject, this._property); }, _initAppProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._appProperty = new Application.motifProperty(obj); }, _initView : function() { var self = this; var sb = []; sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>"; $("#" + self._containerId).html(sb.join("")); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _drawHighChart : function(subject, highlightProperty) { var self = this; var getDataArray = function(tripleList) { var dataArray = []; var dataObject = {}; var array = []; var duplicateProperty = []; $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var val = parseFloat(tValue.object); if (highlightProperty === property) { val = self._getHighLightColumn(parseFloat(tValue.object)); } array.push(val); duplicateProperty.push(property); } }); dataObject.name = self._getLabel(subject); dataObject.data = array; dataArray.push(dataObject); self._getXCategory(tripleList, dataArray, highlightProperty); } LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray); }, _getXCategory : function(tripleList, dataArray, highlightProperty) { var self = this; var array = []; var duplicateProperty = []; var hLabel = self._getLabelAfterHash(highlightProperty); $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var displayLabel = self._getDisplayLabel(label); var hDisplayLabel = self._getDisplayLabel(hLabel); if (displayLabel === hDisplayLabel) { displayLabel = "<span style=\"color:#FB3B44\">" + hDisplayLabel + "</span>"; } array.push(displayLabel); duplicateProperty.push(property); } }); self._drawChart(self._highChartContainerId, dataArray, array); }, _getHighLightColumn : function(val) { var obj = {}; obj.y = val; obj.marker = { lineWidth: 3, lineColor: "#FB3B44", fillColor: "#FB3B44" }; return obj; }, _drawChart : function(containerId, dataArray, xCategory) { var self = this; var chart = new Highcharts.Chart({ chart: { renderTo: containerId, type: 'line', marginRight: 130, marginBottom: 125 }, title: { text: self._fileName }, xAxis: { categories: xCategory, labels : { rotation: 315 } }, tooltip: { formatter: function() { return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']'; } }, legend: { layout: 'vertical', align: 'right', verticalAlign: 'top', x: -10, y: 100, borderWidth: 0 }, series: dataArray }); }, _getLabel : function(value) { var self = this, label; if (value.indexOf("#") > -1) { label = self._getLabelAfterHash(value); } else { label = self._appProperty.getGeneBySubject(value); } if (!label) { label = value; } return label; }, _getPropertyLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); propLabel = this._appProperty.getPropertyNameByLabel(propLabel); } return propLabel; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.motifProperty = function() { this._init.apply(this, arguments); }; Application.motifProperty.prototype = { _options : null, _propMap : null, _nameMap : null, _optionArray : null, _default : { acceptPropLabelPrefix : "label:", subjectATTEDUriPhrase : "http://atted.jp/data/locus/", subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" }, _init : function(options) { this._options = $.extend({}, this._default, options); this._propMap = []; this._nameMap = []; this._initPropMap(this._options); }, _initPropMap : function(opts) { var self = this, workId = opts.workId, fileName = opts.fileName; var method = function(properties) { self._fillPropMap(self, properties); self._initOptionArray(properties); } LinkData.getProperties(workId, fileName, method); }, _fillPropMap : function(self, properties) { $.each(properties, function(key, value) { var label = self._getLabel(value); if (!self._propMap[label]) { self._propMap[label] = value; } }); }, _initOptionArray : function(propertyList) { var self = this, list = new Object(); var workId = self._options.workId, fileName = self._options.fileName; self._optionArray = []; $.each(propertyList, function(key, value) { var propLabel = self._getLabel(value); if (!self._ignore(propLabel)) { var obj = {}; obj.key = propLabel; obj.value = self._getDisplayLabel(propLabel); self._optionArray.push(obj); } }); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, getOptionArray : function() { return this._optionArray; }, getPropertyByLabel : function(label) { return this._propMap[label]; }, getGeneBySubject : function(subject) { var self = this, htmlExt = ".html", geneLabel; if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, ""); } else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, ""); } if (geneLabel && geneLabel.indexOf(htmlExt) > -1) { geneLabel = geneLabel.replace(htmlExt, ""); } return geneLabel; } }; Application.sequence = function() { this._init.apply(this, arguments); }; Application.sequence.prototype = { CHAR_SEQ_EMPTY : "-", _options : null, _workId : null, _fileName : null, _seqProperty : null, _posProperty : null, _baseSequence : null, _sequenceList : null, _positionList : null, _containerId : null, _errorContainerClass : null, _outOfRangeArray : null, _default : { msgInvalidSequence: "invalid sequence.", msgOutOfRangeSequence: "out of range sequence : {0}", }, _init : function(options) { this._options = options; this._workId = this._options.workId; this._fileName = this._options.fileName; this._seqProperty = this._options.motifSequenceProperty; this._posProperty = this._options.motifPositionProperty; this._baseSequence = this._options.baseSequence; this._containerId = this._options.containerId; this._errorContainerClass = this._options.errorMessageClass; }, _getCustomSequenceHtml : function(baseSequence, sequence, position) { var seqLen = sequence.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(position); var baseSeqLen = baseSequence.length; var suffixLen = baseSeqLen - tHold - pos; var sb = []; if (pos > this._options.baseSequenceMinLength && suffixLen > 0) { for (var i = 0; i < suffixLen; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push("<a href='javascript:void(0)' class='motifSequence'>" + sequence + "</a>"); sb.push("<input type='hidden' class='hdnSequence' value='" + sequence + "'/>"); sb.push("<input type='hidden' class='hdnPosition' value='" + pos + "'/>"); } else { //_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence)); this._outOfRangeArray.push(sequence + "[" + pos + "]"); this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.join(", "))); } return sb.join(""); }, _isValidSequenceList : function(seqs) { var count = seqs.length; var maxlength = 0; for (var i = 0; i < count; i++) { if (seqs[i].length > maxlength) { maxlength = seqs[i].length; } } var result = true; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i)); } if (! this._isValidChars(chars.join(""))) { result = false; break; } } return result; }, _isValidBaseReplacementMotif : function(baseSequence, seqs) { var self = this; var mergeSequence = this._getMergeCharSequence(seqs); var length = baseSequence.length; for (var i = 0; i < length; i++) { var bChar = baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY && bChar !== this.CHAR_SEQ_EMPTY && mChar !== bChar) { return false; } } return true; }, _isValidChars : function(charString) { var charLen = charString.length; var result = true; var first = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) == this.CHAR_SEQ_EMPTY) { continue; } if (! first) { first = charString.charAt(i); } var current = charString.charAt(i); if (current && first != current) { result = false; break; } } return result; }, _getReplacedCustomSequence : function(seqs) { var mergeSequence = this._getMergeCharSequence(seqs); var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var bChar = this._baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY) { // replaced sb.push(mChar); } else { sb.push(bChar); } } return sb.join(""); }, _getMergeCharSequence : function(seqs) { var count = seqs.length; var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i) ? seqs[j].charAt(i) : this.CHAR_SEQ_EMPTY); } sb.push(this._getMergeChar(chars.join(""))); } return sb.join(""); }, _getMergeChar : function(charString) { var charLen = charString.length; var result = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) { result = charString.charAt(i); break; } } if (!result) { result = this.CHAR_SEQ_EMPTY; } return result; }, _wrappedReplacedSequenceHtml : function(replaceSequence, seqs) { var self = this, sb = []; var mergeSequence = this._getMergeCharSequence(seqs); var length = this._baseSequence.length; for (var i = 0; i < length; i++) { var bChar = this._baseSequence.charAt(i); var rChar = replaceSequence.charAt(i); var mChar = mergeSequence.charAt(i); var seqChar = (bChar !== rChar) ? "<span class='replace'>" + rChar + "</span>" : rChar; if (mChar !== this.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(seqChar); } } return sb.join(""); }, _getSequenceAndPositionHiddenHtml : function(seqArray, posArray) { var self = this, sb = []; if (!seqArray || !posArray) { return sb.join(""); } for (var i = 0; i < seqArray.length; i++) { sb[sb.length] = "<input type='hidden' class='hdnReplacedMotif' value='" + seqArray[i] + "|" + posArray[i] + "'/>"; } return sb.join(""); }, _showError : function(message) { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass); $errorMessageContainer.html(message); $errorMessageContainer.show(); }, getHtmlByReplacingOldSequence : function(oldSequence, newSequence) { var self = this, sb = []; for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); var seqChar = (oChar !== nChar) ? "<span class='replace'>" + oChar + "</span>" : oChar; if (nChar !== self.CHAR_SEQ_EMPTY) { if (oChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(nChar); } } else { sb.push(oChar); } } return sb.join(""); }, getHtmlByReplacingNewSequence : function(oldSequence, newSequence) { var self = this, sb = []; for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); var seqChar = (oChar !== nChar) ? "<span class='replace'>" + nChar + "</span>" : nChar; if (nChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(oChar); } } return sb.join(""); }, getSequenceHtml : function(subject, drawSequence) { var self = this; self._outOfRangeArray = []; var sb = [], baseSequence = self._baseSequence; var getTriplesBySequenceProperty = function(sequenceList) { self._getTriplesBySequenceProperty(subject, drawSequence, sequenceList); } LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty, getTriplesBySequenceProperty); }, _getTriplesBySequenceProperty : function(subject, drawSequence, sequenceList) { var self = this; var getTriplesByPositionProperty = function(positionList) { self._drawSequenceList(drawSequence, sequenceList, positionList); } LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty, getTriplesByPositionProperty); }, _drawSequenceList : function(drawSequence, sequenceList, positionList) { var self = this, sb = []; if (!sequenceList || sequenceList.length == 0) { return; } for (var i = 0; i < sequenceList.length; i++) { var customSeqString = self._getCustomSequenceHtml(self._baseSequence, sequenceList[i], positionList[i]); if (customSeqString.length > 0) { sb.push("<div class='userSequence'>" + customSeqString + "</div>"); } } drawSequence(sb.join("\n")); }, getFormattedSequence : function(baseSeqLen, seq, pos) { var self = this, sb = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(pos); var len = baseSeqLen - tHold - pos; for (var i = 0; i < len; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } sb[sb.length] = seq; return sb.join(""); }, replace : function(seqs, seqArray, posArray) { var self = this, isValid = self._isValidSequenceList(seqs); if (isValid) { if (seqs.length > 0) { var sb = []; var replaceSeq = self._getReplacedCustomSequence(seqs); sb[sb.length] = self._wrappedReplacedSequenceHtml(replaceSeq, seqs); sb[sb.length] = self._getSequenceAndPositionHiddenHtml(seqArray, posArray); return sb.join(""); } } else { this._showError(self._default.msgInvalidSequence); } }, replaceWith : function(seq, pos, extraCopies, basePairs) { var main = [], seqArray = [], posArray = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(pos); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - tHold - pos; seqArray.push(seq); posArray.push(pos); for (var j = 0; j < extraCopies + 1; j++) { var array = []; for (var i = 0; i < len; i++) { array.push(this.CHAR_SEQ_EMPTY); } array.push(seq); main.push(array.join("")); len = len - seqLen - basePairs; if (len < 0) { break; } } return this.replace(main, seqArray, posArray); }, hideError : function() { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide(); } }; Application.heptamer = function() { this._init.apply(this, arguments); }; Application.heptamer.prototype = { _heptamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { heptamerTag : "heptamer", filterSequencePropertyPhrase : "motif_sequence", filterMaxCEGPropertyPhrase : "maxCEG", filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)" }, _init : function() { this._heptamerMap = []; this._initHeptamerList(); }, _initHeptamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initHeptamer(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._default.heptamerTag, getFilesByTag); }, _initHeptamer : function(workId, fileName) { var self = this; var getPropertyList = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); } LinkData.getProperties(workId, fileName, getPropertyList); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillHeptamerMap(workId, fileName, sequenceTripleList); } LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillHeptamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { for (var i = 0; i < sequenceTripleList.length; i++) { var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[i]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._heptamerMap[seqTriple.object] = seqEl; } } LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._heptamerMap[sequence]; } }; Application.octamer = function() { this._init.apply(this, arguments); } Application.octamer.prototype = { _octamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { octamerTag : "octamer", filterSequencePropertyPhrase : "sequence", filterAppropriatePosition : "Appropriate%20position" }, _init : function() { this._octamerMap = []; this._initOctamerList(); }, _initOctamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initOctamer(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._default.octamerTag, getFilesByTag); }, _initOctamer : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); } LinkData.getProperties(workId, fileName, getProperties); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillOctamerMap(workId, fileName, sequenceTripleList); } LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillOctamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { for (var i = 0; i < sequenceTripleList.length; i++) { var j = Math.floor(i / 2); var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[j]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._octamerMap[seqTriple.object] = seqEl; } } LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._octamerMap[sequence]; } }; Application.seqElement = function() { this._init.apply(this, arguments); }; Application.seqElement.prototype = { _externalUrl : null, _sequence : null, _appropriatePos : null, _init : function() {}, getExternalUrl : function() { return this._externalUrl; }, setExternalUrl : function(externalUrl) { this._externalUrl = externalUrl; }, getSequence : function() { return this._sequence; }, setSequence : function(sequence) { this._sequence = sequence; }, getAppropriatePos : function() { return this._appropriatePos; }, setAppropriatePos : function(appropriatePos) { this._appropriatePos = appropriatePos; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 100; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; } }; Application.index = function() { this._init.apply(this, arguments); } Application.index.prototype = { _start : null, _end : null, _init : function(start, end) { this._start = start; this._end = end; }, getIndex : function() { return {start : this._start, end : this._end}; }, getItemCount : function() { return (this._end - this._start + 1); }, increment : function() { var itemCount = this.getItemCount(); this._start = this._start + itemCount; this._end = this._end + itemCount; return {start : this._start, end : this._end}; }, getStartIndex : function() { return this._start; }, getEndIndex : function() { return this._end; } }; Application.tooltip = function() { this._init.apply(this, arguments); }; Application.tooltip.prototype = { _toolTipList : null, _default : { explanationProperty : "explanation" }, _init : function() { this._toolTipList = []; this._initToolTip(); }, _initToolTip : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._getFilePropertyList(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, "tooltip", getFilesByTag); }, _getFilePropertyList : function(workId, fileName) { var self = this; var index = new Application.index(1, 10000); var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.explanationProperty) > -1) { self._getSubjectList(workId, fileName, pValue, index); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getSubjectList : function(workId, fileName, property, index) { var self = this; var getSubjects = function(subjectList) { self._getPropertyList(subjectList, workId, fileName, property, index); } LinkData.getSubjects(workId, fileName, getSubjects, index); }, _getPropertyList : function(subjectList, workId, fileName, property, index) { var self = this; var getTriplesByProperty = function(tripleList) { self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index); } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index); }, _addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) { var self = this; for (var i = 0; i < subjectList.length; i++) { var key = self._getLabelAfterHash(subjectList[i]); var value = tripleList[i].object; self._addToolTip(key, value); } if (subjectList && subjectList.length == index.getItemCount()) { self._getSubjectList(workId, fileName, property, index.increment()); } }, _addToolTip : function(key, tooltip) { var obj = {}; obj.key = key; obj.tooltip = tooltip; this._toolTipList.push(obj); }, getByKey : function(key) { var self = this, tooltip; $.each(self._toolTipList, function(objKey, obj) { if (obj.key === key) { tooltip = obj.tooltip; return false; } }); return (tooltip) ? tooltip : ""; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; $(document).ready(function() { var fillDatabase = function(resultList) { $(".motifMaxCircadianDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>"); $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { $(".motifMaxCircadianDatabase").append("<option value='" + workId + "|" + fileName + "'>" + fileName + "</option>"); }); }); $(".motifMaxCircadianDatabase").change(function() { var dbKey = $("option:selected", $(this)).val(); if (dbKey == -1) { $("#container").html(""); return; } var array = dbKey.split("|"); var containerId = "container"; var options = { workId : array[0], fileName : array[1], //baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" baseSequence : "------------------------------------------------------------------GGGATGGCAC---------------------GACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" }; new Application.motifMaxCircadian(containerId, options); }); } LinkData.getFilesByTag(null, "database", fillDatabase); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 125px; } .row { padding: 5px 0; } .row:after { content: ""; clear: left; display: block; } .row input[type="text"] { width: 200px; } .row .externalLink { margin: 0 5px; } .highlight-sequence { font-weight: bold; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; white-space: nowrap; } .replaceSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; width: 100%; overflow: auto; white-space: nowrap; } .replace { color: #E80010; } .errorMessage { color: #FF0000; text-align: center; } .databaseInfo .motif { width: 70%; } /** * button css */ .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .basePairs, .motifViewDialog .extraCopies, .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; } .loadingImageContainer .loadingMessage { color: #FF0000; } .motifConflictionDialog .option { margin: 10px; }
<div class="row"> <div class="label left">Select Database</div> <div class="left"><select class="motifMaxCircadianDatabase"></select></div> </div> <div id="container"></div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Jan 15, 2013
7487 Downloads, 27 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the CEG motifs as calculated by ATTED-II. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style="text-align:left;"> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site. </td> </tr> <tr> <th nowrap> motif </th> <td> A link to the database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> CEG </th> <td> The Coexpression Expression Group score as calculated by ATTED-II. </td> </tr> <tr> <th nowrap> Probe Condition </th> <td> The strain and growth condition of the 44 hour experiment. </td> </tr> <tr> <th nowrap> Phase </th> <td> The phase of circadian response, calculated by sine wave fitting. </td> </tr> <tr> <th nowrap> Correlation </th> <td> The correlation coefficient of the fitted sine wave with the circadian oscillation. </td> </tr> <tr> <th> label:Expression X hours </th> <td> The gene expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_COL_LDHH.html#work_information'>DiurnalHours_ATTED_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_COL_SD.html#work_information'>DiurnalHours_ATTED_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_DD_DDHC.html#work_information'>DiurnalHours_ATTED_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHC.html#work_information'>DiurnalHours_ATTED_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHH_SM.html#work_information'>DiurnalHours_ATTED_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LDHH_ST.html#work_information'>DiurnalHours_ATTED_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LER_SD.html#work_information'>DiurnalHours_ATTED_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_ATTED_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LIGHT5_znknOX.html#work_information'>DiurnalHours_ATTED_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL12_LDHH.html#work_information'>DiurnalHours_ATTED_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL23_LDHH.html#work_information'>DiurnalHours_ATTED_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LLHC.html#work_information'>DiurnalHours_ATTED_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL_LDHC.html#work_information'>DiurnalHours_ATTED_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_LL_LLHC.html#work_information'>DiurnalHours_ATTED_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_lhyox_SD.html#work_information'>DiurnalHours_ATTED_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_longday.html#work_information'>DiurnalHours_ATTED_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_lux_2_LDHH.html#work_information'>DiurnalHours_ATTED_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_phyB9_SD.html#work_information'>DiurnalHours_ATTED_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s330i/DiurnalHours_ATTED_shortday.html#work_information'>DiurnalHours_ATTED_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_ATTED_COL_LDHH
[
database
]
DiurnalHours_ATTED_COL_SD
DiurnalHours_ATTED_DD_DDHC
DiurnalHours_ATTED_LDHC
DiurnalHours_ATTED_LDHH_SM
DiurnalHours_ATTED_LDHH_ST
DiurnalHours_ATTED_LER_SD
DiurnalHours_ATTED_LIGHT5_HIF138_13
DiurnalHours_ATTED_LIGHT5_HIF138_8
DiurnalHours_ATTED_LIGHT5_znknOX
DiurnalHours_ATTED_LL12_LDHH
DiurnalHours_ATTED_LL23_LDHH
DiurnalHours_ATTED_LLHC
DiurnalHours_ATTED_LL_LDHC
DiurnalHours_ATTED_LL_LLHC
DiurnalHours_ATTED_lhyox_SD
DiurnalHours_ATTED_longday
DiurnalHours_ATTED_lux_2_LDHH
DiurnalHours_ATTED_phyB9_SD
DiurnalHours_ATTED_shortday
Circadian Genomic (DIURNAL + PPDB promoter motif) Full
Contributor:GenoCon
Update:Jan 15, 2013
7316 Downloads, 29 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the LDSS motifs as calculated by PPDB. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> PPDB motif </th> <td> A link to the PPDB database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif type </th> <td> Type of the PPDB promoter motif. The identified octamers have been classified into regulatory element group (REG), TATA box, and Y Patch. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site (TSS). </td> </tr> <tr> <th nowrap> genome_version </th> <td> The genome version of annotated motifs. </td> </tr> <tr> <th nowrap> TAIR_gene </th> <td> Gene information associated with the motifs. </td> </tr> <tr> <th nowrap> chromosome </th> <td> Chromosome number the gene belongs. </td> </tr> <tr> <th nowrap> position start </th> <td> The absolute start position of the motif. </td> </tr> <tr> <th nowrap> position start from TSS peak </th> <td> The position of the motif start relative to the TSS peak. </td> </tr> <tr> <th nowrap> position end </th> <td> The absolute end position of the motif. </td> </tr> <tr> <th nowrap> position end from TSS peak </th> <td> The position of the motif end relative to the TSS peak. </td> </tr> <tr> <th nowrap> strand </th> <td> The strand of the feature. + for positive strand, - for minus strand. </td> </tr> <tr> <th nowrap> TSS peak position </th> <td> The absolute position of the TSS peak, which is the most probable TSS position determined by the CT-MPSS method. </td> </tr> <tr> <th> TSS peak position from Initial codon </th> <td> The position of the TSS peak relative to Initial codon. </td> </tr> <tr> <th nowrap> Initial codon </th> <td> The absolute position of the Initial codon. </td> </tr> <tr> <th nowrap> label:Expression X hours </th> <td> The gene expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_LDHH.html#work_information'>DiurnalHours_PPDB_COL_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_COL_SD.html#work_information'>DiurnalHours_PPDB_COL_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_DD_DDHC.html#work_information'>DiurnalHours_PPDB_DD_DDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Dark (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Dark (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHC.html#work_information'>DiurnalHours_PPDB_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_SM.html#work_information'>DiurnalHours_PPDB_LDHH_SM</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Smith method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LDHH_ST.html#work_information'>DiurnalHours_PPDB_LDHH_ST</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h), by using the Stitt method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LER_SD.html#work_information'>DiurnalHours_PPDB_LER_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler (Landsberg-ereta) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_13.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_13</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-13 (HETEROGENOUS INBRED FAMILY 138-13) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_HIF138_8.html#work_information'>DiurnalHours_PPDB_LIGHT5_HIF138_8</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis hif138-8 (HETEROGENOUS INBRED FAMILY 138-8) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LIGHT5_znknOX.html#work_information'>DiurnalHours_PPDB_LIGHT5_znknOX</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis tsp-ox (hif138-8) (TANDEM ZINCKNUCKLE PROTEIN-ox) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL12_LDHH.html#work_information'>DiurnalHours_PPDB_LL12_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL23_LDHH.html#work_information'>DiurnalHours_PPDB_LL23_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (24h), and subjected to Light (24h) by the Miller method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LLHC.html#work_information'>DiurnalHours_PPDB_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LDHC.html#work_information'>DiurnalHours_PPDB_LL_LDHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Dark (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_LL_LLHC.html#work_information'>DiurnalHours_PPDB_LL_LLHC</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Columbia strain 0, grown under the circadian condition Light (12h) Light (12h) / Hot (12h) / Cold (12h), and subjected to Light (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lhyox_SD.html#work_information'>DiurnalHours_PPDB_lhyox_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lhy (lhy-ox) (LATE ELONGATED HYPOCOTYL) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_longday.html#work_information'>DiurnalHours_PPDB_longday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of long day light, that is, Light (16h) Dark (8h) by using the Kay method. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_lux_2_LDHH.html#work_information'>DiurnalHours_PPDB_lux_2_LDHH</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis lux-2 (LUX ARRHYTHMO-2) strain, grown under the circadian condition Light (12h) Dark (12h) / Hot (24h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_phyB9_SD.html#work_information'>DiurnalHours_PPDB_phyB9_SD</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis phyB9 (PHYTOCHROME B-9) strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h). </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s331i/DiurnalHours_PPDB_shortday.html#work_information'>DiurnalHours_PPDB_shortday</a> </td> <td> <br> This collection of Gene Expression Properties are associated with the Arabidopsis Ler strain, grown under the circadian condition of short day light, that is, Light (8h) Dark (16h) by using the Kay method. </td> </tr> </table>
DiurnalHours_PPDB_COL_LDHH
[
database
]
DiurnalHours_PPDB_COL_SD
DiurnalHours_PPDB_DD_DDHC
DiurnalHours_PPDB_LDHC
DiurnalHours_PPDB_LDHH_SM
DiurnalHours_PPDB_LDHH_ST
DiurnalHours_PPDB_LER_SD
DiurnalHours_PPDB_LIGHT5_HIF138_13
DiurnalHours_PPDB_LIGHT5_HIF138_8
DiurnalHours_PPDB_LIGHT5_znknOX
DiurnalHours_PPDB_LL12_LDHH
DiurnalHours_PPDB_LL23_LDHH
DiurnalHours_PPDB_LLHC
DiurnalHours_PPDB_LL_LDHC
DiurnalHours_PPDB_LL_LLHC
DiurnalHours_PPDB_lhyox_SD
DiurnalHours_PPDB_longday
DiurnalHours_PPDB_lux_2_LDHH
DiurnalHours_PPDB_phyB9_SD
DiurnalHours_PPDB_shortday
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Mar 6, 2013
4959 Downloads, 32 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Flowering.html#work_information'>AtGenExpress_ATTED_Flowering</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Fruit_Seeds.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Leaf.html#work_information'>AtGenExpress_ATTED_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Root.html#work_information'>AtGenExpress_ATTED_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Seedling.html#work_information'>AtGenExpress_ATTED_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Stem.html#work_information'>AtGenExpress_ATTED_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Whole_Plant.html#work_information'>AtGenExpress_ATTED_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> </table> . </td> </tr> </table>
AtGenExpress_ATTED_Flowering
AtGenExpress_ATTED_Fruit_Seeds
AtGenExpress_ATTED_Leaf
AtGenExpress_ATTED_Root
AtGenExpress_ATTED_Seedling
AtGenExpress_ATTED_Stem
AtGenExpress_ATTED_Whole_Plant
Heptamer_elements
PPDB_position
[
]
Speedup Lists of Circadian Genomic (DIURNAL + PPDB promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
4146 Downloads, 23 Applications
Lists for the Diurnal and PPDB mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by circadian amplitude. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for Diurnal)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Expression X hours </th> <td> The genes ranked by absolute expression level after the seedling has been growing for X hours, starting at 7 days. </td> </tr> <tr> <th nowrap> condition:Conditions_Range </th> <td> The genes ranked by absolute expression level under the given condition, and for the given circadian phase range. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_0to4_top.html#work_information'>DiurnalHours_PPDB_0to4_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 0 to 4 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_4to8_top.html#work_information'>DiurnalHours_PPDB_4to8_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 4 to 8 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_8to12_top.html#work_information'>DiurnalHours_PPDB_8to12_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 8 to 12 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_12to16_top.html#work_information'>DiurnalHours_PPDB_12to16_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 12 to 16 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_16to20_top.html#work_information'>DiurnalHours_PPDB_16to20_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 16 to 20 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_20to24_top.html#work_information'>DiurnalHours_PPDB_20to24_top</a> </td> <td> Lists for the DIURNAL and PPDB mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level, for circadian phase range 20 to 24 hr. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_top.html#work_information'>DiurnalHours_PPDB_top</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_bottom.html#work_information'>DiurnalHours_PPDB_bottom</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the bottom 1000 genes ranked by circadian amplitude. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s343i/DiurnalHours_PPDB_all.html#work_information'>DiurnalHours_PPDB_all</a> </td> <td> Lists for the DIURNAL and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by circadian amplitude. </td> </tr> </table>
DiurnalHours_PPDB_0to4_top
[
result_top
]
DiurnalHours_PPDB_12to16_top
[
result_top
]
DiurnalHours_PPDB_16to20_top
[
result_top
]
DiurnalHours_PPDB_20to24_top
[
result_top
]
DiurnalHours_PPDB_4to8_top
[
result_top
]
DiurnalHours_PPDB_8to12_top
[
result_top
]
DiurnalHours_PPDB_all
[
]
DiurnalHours_PPDB_bottom
[
result_bottom
]
DiurnalHours_PPDB_top
[
result_top
]
Developmental Genomic (AtGenExpress + PPDB promoter motif) Full
Contributor:GenoCon
Update:Jan 22, 2013
4017 Downloads, 27 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). For each motif, we calculated the position relative to the TSS as determined experimentally (PPDB). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> PPDB motif </th> <td> A link to the PPDB database page for the given cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif type </th> <td> Type of the PPDB promoter motif. The identified octamers have been classified into regulatory element group (REG), TATA box, and Y Patch. </td> </tr> <tr> <th nowrap> motif sequence </th> <td> The sequence of the cis-regulatory motif. </td> </tr> <tr> <th nowrap> motif position </th> <td> The distance from the center base pair to the transcription start site (TSS). </td> </tr> <tr> <th nowrap> genome_version </th> <td> The genome version of annotated motifs. </td> </tr> <tr> <th nowrap> TAIR_gene </th> <td> Gene information associated with the motifs. </td> </tr> <tr> <th nowrap> chromosome </th> <td> Chromosome number the gene belongs. </td> </tr> <tr> <th nowrap> position start </th> <td> The absolute start position of the motif. </td> </tr> <tr> <th nowrap> position start from TSS peak </th> <td> The position of the motif start relative to the TSS peak. </td> </tr> <tr> <th nowrap> position end </th> <td> The absolute end position of the motif. </td> </tr> <tr> <th nowrap> position end from TSS peak </th> <td> The position of the motif end relative to the TSS peak. </td> </tr> <tr> <th nowrap> strand </th> <td> The strand of the feature. + for positive strand, - for minus strand. </td> </tr> <tr> <th nowrap> TSS peak position </th> <td> The absolute position of the TSS peak, which is the most probable TSS position determined by the CT-MPSS method. </td> </tr> <tr> <th> TSS peak position from Initial codon </th> <td> The position of the TSS peak relative to Initial codon. </td> </tr> <tr> <th nowrap> Initial codon </th> <td> The absolute position of the Initial codon. </td> </tr> <tr> <th nowrap> label:Conditions </th> <td> The gene expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Flowering.html#work_information'>AtGenExpress_PPDB_Flowering</a> </td> <td> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Fruit_Seeds.html#work_information'>AtGenExpress_PPDB_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Leaf.html#work_information'>AtGenExpress_PPDB_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Root.html#work_information'>AtGenExpress_PPDB_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Seedling.html#work_information'>AtGenExpress_PPDB_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Stem.html#work_information'>AtGenExpress_PPDB_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/AtGenExpress_PPDB_Whole_Plant.html#work_information'>AtGenExpress_PPDB_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s329i/Octamer_elements.html#work_information'>Octamer_elements</a> </td> <td> A list of the 8mer sequence motifs from PPDB. This table lists each 8mer along with the appropriate median position from the TSS, calculated from all 8mers. </td> </tr> </table>
AtGenExpress_PPDB_Flowering
AtGenExpress_PPDB_Fruit_Seeds
AtGenExpress_PPDB_Leaf
AtGenExpress_PPDB_Root
AtGenExpress_PPDB_Seedling
AtGenExpress_PPDB_Stem
AtGenExpress_PPDB_Whole_Plant
Octamer_elements
[
octamer
]
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s154i?tab=readme
Initial content
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
Work
Add
Clear
insert work id or work name.