Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
MotifMinCircadian
useful
0
Loading...
MotifMinCircadian = function(containerId, options) { new Application.motifMinCircadian(containerId, options); }; if (Application === "undefined" || !Application) { var Application = {}; } // Application.motifMinCircadian method Application.motifMinCircadian = function() { this._init.apply(this, arguments); }; Application.motifMinCircadian.prototype = { // Initialization _containerId : null, _baseSequence : null, _options : null, _motifProperty : null, _heptamer : null, _octamer : null, _appSequence : null, _filteredSubjectList : null, _motifViewDialogId : null, _default : { appName : "MotifMinCircadian", selectRangeCaption : "Select Range", selectPropertyAreaClass : "selectPropertyArea", selectPropertyClass : "selectProperty", resultAreaClass : "resultArea", replaceButtonAreaClass : "replaceButtonArea", replaceButtonClass : "replaceButton", nextButtonAreaClass : "nextButtonArea", replaceSequenceClass : "replaceSequence", errorMessageAreaClass : "errorMessage", dialogErrorMessageClass : "dialogErrorMessage", dialogOutRangeValueMessage : "Please input a value between {0} and {1}", noSequenceForThisRange : "No sequence found for this range", databaseInfoClass : "databaseInfo", motifSequenceProperty : "motif sequence", motifPositionProperty : "motif position", sinePhaseProperty : "Sine Phase", sineAmplitudeProperty : "Sine Amplitude", typeProperty : "type", validType : "REG", motifViewDialogId : "motifViewDialog", motifViewDialogClass : "motifViewDialog", motifViewDialogTitle : "Motif View", minSequenceClass : "minSeq", maxSequenceClass : "maxSeq", websiteNameAtted : "ATTED", websiteNamePpdb : "PPDB", baseSequenceMinLength : 50, dialogImageUrl : "http://app.linkdata.org/asset/0aea5a0d.png", callback : function() {} }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._baseSequence = this._options.baseSequence; this.filteredSubjectList = []; this._initMotifProperty(this._options); this._initAppSequence(this._options); this._initHeptamer(); this._initOctamer(); this._initFiltering(this._options); this._initView(); this._initListener(); this._initMotifViewDialog(); }, _initMotifProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._motifProperty = new Application.motifProperty(obj); }, _initAppSequence : function(opts) { var seqProperty = this._motifProperty.getPropertyByLabel(this._options.motifSequenceProperty); var posProperty = this._motifProperty.getPropertyByLabel(this._options.motifPositionProperty); var obj = { workId : opts.workId, fileName : opts.fileName, baseSequence : this._baseSequence, motifSequenceProperty : seqProperty, motifPositionProperty : posProperty, containerId : this._containerId, errorMessageClass : this._options.errorMessageAreaClass, baseSequenceMinLength : this._options.baseSequenceMinLength }; this._appSequence = new Application.sequence(obj); }, _initHeptamer : function() { this._heptamer = new Application.heptamer(); }, _initOctamer : function() { this._octamer = new Application.octamer(); }, _initView : function() { this._initMainView(); this._initDialogView(); }, _initMainView : function() { var self = this; var optionArray = this._motifProperty.getOptionArray(); var sb = []; sb[sb.length] = "<div class='" + this._options.selectPropertyAreaClass + " row'>"; sb[sb.length] = "<div class='label left'>" + this._options.selectRangeCaption + "</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<select class='" + this._options.selectPropertyClass + "'>"; sb[sb.length] = "<option value='-1'>-- Select Range --</option>"; sb[sb.length] = "<option value='0-4'>0 to 4</option>"; sb[sb.length] = "<option value='4-8'>4 to 8</option>"; sb[sb.length] = "<option value='8-12'>8 to 12</option>"; sb[sb.length] = "<option value='12-16'>12 to 16</option>"; sb[sb.length] = "<option value='16-20'>16 to 20</option>"; sb[sb.length] = "<option value='20-24'>20 to 24</option>"; sb[sb.length] = "</select>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + this._options.resultAreaClass + " hidden'></div>"; sb[sb.length] = "<div class='" + this._options.replaceButtonAreaClass + " hidden'>"; sb[sb.length] = "<a class='" + this._options.replaceButtonClass + " btn btn-lightblue'>Replace</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + this._options.databaseInfoClass + " hidden'></div>"; sb[sb.length] = "<div class='" + this._options.replaceSequenceClass + " hidden'></div>"; sb[sb.length] = "<div class='" + this._options.errorMessageAreaClass + " hidden'>error</div>"; $("#" + this._containerId).append(sb.join("")); }, _initDialogView : function() { var sb = [], self = this, date = new Date(); this._motifViewDialogId = "motifViewDialog_id_" + self._containerId; sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Replace with prefer position between "; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='motifImageArea'>"; sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Click "; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initFiltering : function(opts) { var self = this; var seqProperty = self._motifProperty.getPropertyByLabel(opts.motifSequenceProperty); var posProperty = self._motifProperty.getPropertyByLabel(opts.motifPositionProperty); var typeProperty = self._motifProperty.getPropertyByLabel(opts.typeProperty); var tripleList = LinkData.getTriplesByProperty(opts.workId, opts.fileName, seqProperty); $.each(tripleList, function(key, value) { var validPos = false; var validType = true; $.each(LinkData.getObjects(opts.workId, opts.fileName, value.subject, posProperty), function(posKey, posValue) { var tmpPos = parseInt(posValue); if (opts.baseSequenceMinLength < tmpPos && opts.baseSequence.length >= tmpPos) { validPos = true; } }); $.each(LinkData.getObjects(opts.workId, opts.fileName, value.subject, typeProperty), function(typeKey, typeValue) { if (opts.validType !== typeValue) { validType = false; } }); var valid = validPos && validType; if (valid && value.object.length > 0 && $.inArray(value.subject, self.filteredSubjectList) < 0) { self.filteredSubjectList.push(value.subject); } }); }, _initListener : function() { this._initSelectPropertyListener(); this._initReplaceButtonLitener(); }, _initSelectPropertyListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var property = self._motifProperty.getPropertyByLabel(self._options.sinePhaseProperty); $("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() { self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.resultAreaClass).show(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); var range = $("option:selected", this).val(); if (range && range != -1) { var triple = self._getMotifMinCircadianTriple(workId, fileName, range); if (triple) { self._motifMinCircadianSequence(workId, fileName, triple.subject); self._initMotifSequenceListener(); } else { self._appSequence._showError(self._options.noSequenceForThisRange); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } } }); }, _initReplaceButtonLitener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; $("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() { self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); var seqs = []; $("#" + self._containerId + " .userSequence").each(function() { seqs.push($(this).text()); }); var seqVal = []; $("#" + self._containerId + " .userSequence .hdnSequence").each(function() { seqVal.push($(this).val()); }); var html = self._appSequence.replace(seqs); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html); self._showDatabaseInfo(seqVal); self._options.callback(); }); }, _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { $("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var container = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); var pos = $(parent).find(".hdnPosition").val(); var seqEl = self._getSeqElBySeq(seq); var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; self._initSequencePopup(seqEl); $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide(); $("#" + self._motifViewDialogId + " .sequence").val(seq); $("#" + self._motifViewDialogId + " .position").val(appropriatePos); $("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq)); $("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq)); self._initPositionInsert(seq, appropriatePos); $("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); $("#" + self._motifViewDialogId).dialog("open"); $("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); }, _initSequencePopup : function(seqEl) { var self = this; $("#" + self._motifViewDialogId + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; $("#" + self._motifViewDialogId + " .moreInfo").click(function() { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2)); var winTop = parseInt((screen.availHeight/2) - (winHeight/2)); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }); }, _initPositionInsert : function(seq, pos) { var self = this; var mod = seq.length % 2; $("#" + self._motifViewDialogId + " .position").unbind("keyup"); $("#" + self._motifViewDialogId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(val); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); }, _initMotifViewDialog : function() { var self = this; $("#" + self._motifViewDialogId).dialog({ autoOpen: false, title: self._default.motifViewDialogTitle, width: 520, dialogClass : self._options.motifViewDialogClass, buttons : [ { text: "Replace", click : function() { var seq = $("#" + self._motifViewDialogId).find(".sequence").val(); var pos = $("#" + self._motifViewDialogId).find(".position").val(); var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val()); var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val()); var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html()); var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html()); if (minPos > pos || maxPos < pos) { $dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass); $dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); $dialogError.show(); return; } self._replaceWithSequence(seq, pos, extraCopies, basePairs); $(this).dialog("close"); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, // Get triples of motif with minimum circadian amplitude _getMotifMinCircadianTriple : function(workId, fileName, range) { var self = this; var property = self._motifProperty.getPropertyByLabel(self._options.sinePhaseProperty); var amplitudeProperty = self._motifProperty.getPropertyByLabel(self._options.sineAmplitudeProperty); var triples = LinkData.getTriplesByProperty(workId, fileName, property); var arr = range.split("-"); var startValue = arr[0]; var endValue = arr[1]; // var maxIndex = -1; // var maxValue = -99999; var minIndex = -1; var minValue = 99999; $.each (triples, function(tKey, tValue) { var tmpVal = parseFloat(tValue.object); if ($.inArray(tValue.subject, self.filteredSubjectList) >= 0 && tmpVal >= startValue && tmpVal < endValue) { var amplitude = LinkData.getObjects(workId, fileName, tValue.subject, amplitudeProperty)[0]; // if (maxValue < amplitude) { // maxValue = amplitude; // maxIndex = tKey; // } if (minValue > amplitude) { minValue = amplitude; minIndex = tKey; } } }); // if (maxIndex != -1) { // return triples[maxIndex]; // } if (minIndex != -1) { return triples[minIndex]; } return; }, _getDataBaseWebsiteName : function() { var self = this; var fileName = self._options.fileName if (fileName.indexOf(self._options.websiteNameAtted) > -1) { return self._options.websiteNameAtted; } else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) { return self._options.websiteNamePpdb; } else { return "UNKNOWN"; } }, _motifMinCircadianSequence : function(workId, fileName, subject) { var self = this, seqHtml = self._appSequence.getSequenceHtml(subject); var sb = []; sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>"; sb[sb.length] = seqHtml; $("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join("")); if (seqHtml.length == 0) { $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } }, _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 1 : 0.5; return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; }, _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; }, _getSeqElBySeq : function(seq) { if (seq && seq.trim().length == 7) { return this._heptamer.getBySequence(seq); } else if (seq && seq.trim().length == 8) { return this._octamer.getBySequence(seq); } }, _showDatabaseInfo : function(seqVal) { var self = this, fileName = self._options.fileName, appName = self._options.appName; var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val(); var label = self._motifProperty.getPropertyNameByLabel(propLabel); label = (label && label.trim().length != 0) ? label : propLabel; var usedMotif = (seqVal.length != 0) ? seqVal.toString() : "-"; var dbInfoHtml = self._getDatabaseInfo(fileName, appName, label, usedMotif); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); }, _getDatabaseInfo : function(fileName, method, property, motif) { var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Database</div>"; sb[sb.length] = "<div class='left'>" + fileName + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Application</div>"; sb[sb.length] = "<div class='left'>" + method + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Range</div>"; sb[sb.length] = "<div class='left'>" + property + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif</div>"; sb[sb.length] = "<div class='left'>" + motif + "</div>"; sb[sb.length] = "</div>"; return sb.join(""); }, _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this; var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); self._showDatabaseInfo(seq); self._options.callback(); } }; // Application.motifProperty method Application.motifProperty = function() { this._init.apply(this, arguments); }; Application.motifProperty.prototype = { _options : null, _propMap : null, _nameMap : null, _default : { nameMappingNamespace : "http://atted.jp/help/slide_GeneExp_v3.shtml#", nameMappingProperty : "http://purl.org/dc/elements/1.1/title", propertyMappingExpression : "Expression", propertyMappingWorkUri : "http://linkdata.org/work" }, _init : function(options) { this._options = $.extend({}, this._default, options); this._propMap = []; this._nameMap = []; this._initPropMap(this._options); this._initNameMap(); }, _initPropMap : function(opts) { var self = this, workId = opts.workId, fileName = opts.fileName; $.each(LinkData.getProperties(workId, fileName), function(key, value) { var label = self._getLabel(value); if (!self._propMap[label]) { self._propMap[label] = value; } }); }, _initNameMap : function() { var self = this, nameKey; $.each(LinkData.getWorks(), function(workKey, workId) { $.each(LinkData.getFiles(workId), function(fileKey, fileName) { $.each(LinkData.getSubjects(workId, fileName), function(subKey, subValue) { nameKey = self._getNameKey(subValue); if (nameKey) { var nameArray = LinkData.getObjects(workId, fileName, subValue, self._options.nameMappingProperty); if (nameArray && nameArray.length > 0) { self._nameMap[nameKey] = nameArray[0]; } } }); }); }); }, _getNameKey : function(value) { var key; if (value && value.indexOf(this._options.nameMappingNamespace) >= 0) { key = value.split("#")[1]; } return key; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, getOptionArray : function() { var self = this, list = new Object(); var workId = self._options.workId, fileName = self._options.fileName; $.each(LinkData.getProperties(workId, fileName), function(key, value) { if (value.indexOf(self._options.propertyMappingWorkUri) > -1 || value.indexOf(self._options.propertyMappingExpression) > -1) { var propLabel = self._getLabel(value); var name = self._nameMap[propLabel]; list[propLabel] = (name) ? name : propLabel; } }); return list; }, getPropertyByLabel : function(label) { return this._propMap[label]; }, getPropertyNameByLabel : function(label) { return this._nameMap[label]; } }; // Application.sequence method Application.sequence = function() { this._init.apply(this, arguments); }; Application.sequence.prototype = { CHAR_SEQ_EMPTY : "-", _options : null, _workId : null, _fileName : null, _seqProperty : null, _posProperty : null, _baseSequence : null, _sequenceList : null, _positionList : null, _containerId : null, _errorContainerClass : null, _outOfRangeArray : null, _default : { msgInvalidSequence: "invalid sequence.", msgOutOfRangeSequence: "out of range sequence : {0}", }, _init : function(options) { this._options = options; this._workId = this._options.workId; this._fileName = this._options.fileName; this._seqProperty = this._options.motifSequenceProperty; this._posProperty = this._options.motifPositionProperty; this._baseSequence = this._options.baseSequence; this._containerId = this._options.containerId; this._errorContainerClass = this._options.errorMessageClass; }, _getCustomSequenceHtml : function(baseSequence, sequence, position) { var seqLen = sequence.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(position); var baseSeqLen = baseSequence.length; var suffixLen = baseSeqLen - tHold - pos; var sb = []; if (pos > this._options.baseSequenceMinLength && suffixLen > 0) { for (var i = 0; i < suffixLen; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push("<a href='javascript:void(0)' class='motifSequence'>" + sequence + "</a>"); sb.push("<input type='hidden' class='hdnSequence' value='" + sequence + "'/>"); sb.push("<input type='hidden' class='hdnPosition' value='" + pos + "'/>"); } else { //_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence)); this._outOfRangeArray.push(sequence + "[" + pos + "]"); this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.toString())); } return sb.join(""); }, _isValidSequenceList : function(seqs) { var count = seqs.length; var maxlength = 0; for (var i = 0; i < count; i++) { if (seqs[i].length > maxlength) { maxlength = seqs[i].length; } } var result = true; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i)); } if (! this._isValidChars(chars.join(""))) { result = false; break; } } return result; }, _isValidChars : function(charString) { var charLen = charString.length; var result = true; var first = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) == this.CHAR_SEQ_EMPTY) { continue; } if (! first) { first = charString.charAt(i); } var current = charString.charAt(i); if (current && first != current) { result = false; break; } } return result; }, _getReplacedCustomSequence : function(seqs) { var mergeSequence = this._getmergeCharSequence(seqs); var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var bChar = this._baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY) { // replaced sb.push(mChar); } else { sb.push(bChar); } } return sb.join(""); }, _getmergeCharSequence : function(seqs) { var count = seqs.length; var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i) ? seqs[j].charAt(i) : this.CHAR_SEQ_EMPTY); } sb.push(this._getMergeChar(chars.join(""))); } return sb.join(""); }, _getMergeChar : function(charString) { var charLen = charString.length; var result = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) { result = charString.charAt(i); break; } } if (!result) { result = this.CHAR_SEQ_EMPTY; } return result; }, _wrappedReplacedSequenceHtml : function(replaceSequence, seqs) { var mergeSequence = this._getmergeCharSequence(seqs); var length = this._baseSequence.length; var sb = []; for (var i = 0; i < length; i++) { var bChar = this._baseSequence.charAt(i); var rChar = replaceSequence.charAt(i); var mChar = mergeSequence.charAt(i); var seqChar = (bChar !== rChar) ? "<span class='replace'>" + rChar + "</span>" : rChar; if (mChar !== this.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(seqChar); } } return sb.join(""); }, _showError : function(message) { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass); $errorMessageContainer.html(message); $errorMessageContainer.show(); }, getSequenceHtml : function(subject) { var self = this; self._outOfRangeArray = []; var sequenceList = LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty); var positionList = LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty); var sb = [], baseSequence = self._baseSequence; for (var i = 0; i < sequenceList.length; i++) { var customSeqString = this._getCustomSequenceHtml(baseSequence, sequenceList[i], positionList[i]); if (customSeqString.length > 0) { sb.push("<div class='userSequence'>" + customSeqString + "</div>"); } } return sb.join("\n"); }, replace : function(seqs) { var isValid = this._isValidSequenceList(seqs); if (isValid) { if (seqs.length > 0) { var replaceSeq = this._getReplacedCustomSequence(seqs); var replaceSeqHtml = this._wrappedReplacedSequenceHtml(replaceSeq, seqs); return replaceSeqHtml; } } else { //$appContainer.find("." + opts.appReplaceResultAreaContainerClz).hide(); //_showError($appContainer, opts.msgInvalidSequence); this._showError(this._default.msgInvalidSequence); } }, replaceWith : function(seq, pos, extraCopies, basePairs) { var main = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(pos); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - tHold - pos; for (var j = 0; j < extraCopies + 1; j++) { var array = []; for (var i = 0; i < len; i++) { array.push(this.CHAR_SEQ_EMPTY); } array.push(seq); main.push(array.join("")); len = len - seqLen - basePairs; if (len < 0) { break; } } return this.replace(main); }, hideError : function() { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide(); } }; // Application.heptamer method Application.heptamer = function() { this._init.apply(this, arguments); }; Application.heptamer.prototype = { _heptamerMap : null, _default : { filterSubjectUrlPhrase : "http://atted.jp/data/cis/", filterSequencePropertyPhrase : "motif%20sequence", filterMaxCEGPropertyPhrase : "maxCEG", filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)" }, _init : function() { this._heptamerMap = new Object(); this._initHeptamerList(); }, _initHeptamerList : function() { var self = this; $.each(LinkData.getWorks(), function(workKey, workId) { $.each(LinkData.getFiles(workId), function(fileKey, fileName) { $.each(LinkData.getSubjects(workId, fileName), function(subKey, subValue) { if (self._isHeptamerSubject(subValue)) { var triples = LinkData.getTriplesBySubject(workId, fileName, subValue); //var obj = self._getObjectByTriple(triples); var seqEl = self._getObjectByTriple(triples); var seq = seqEl.getSequence(); if (seq && seq.trim().length != 0) { seqEl.setExternalUrl(subValue); //obj.url = subValue; self._heptamerMap[seq] = seqEl; } } }); }); }); }, _getObjectByTriple : function(triples) { var self = this; //var obj = {}; var seqEl = new Application.seqElement(); $.each(triples, function(key, value) { var property = value.property; if (property.indexOf(self._default.filterSequencePropertyPhrase) >= 0) { seqEl.setSequence(value.object); //obj.sequence = value.object; } else if (property.indexOf(self._default.filterAppropriatePosition) >= 0) { seqEl.setAppropriatePos(value.object); //obj.appropriatePos = value.object; } }); return seqEl; }, _isHeptamerSubject : function(subject) { var self = this; if (!subject) { return false; } if (subject.indexOf(self._default.filterSubjectUrlPhrase) > -1) { return true; } return false; }, getBySequence : function(sequence) { return this._heptamerMap[sequence]; } }; // Application.octamer method Application.octamer = function() { this._init.apply(this, arguments); }; Application.octamer.prototype = { _octamerMap : null, _default : { filterSubjectUrlPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/", filterSequencePropertyPhrase : "sequence", filterAppropriatePosition : "Appropriate%20position" }, _init : function() { this._octamerMap = new Object(); this._initOctamerList(); }, _initOctamerList : function() { var self = this; $.each(LinkData.getWorks(), function(workKey, workId) { $.each(LinkData.getFiles(workId), function(fileKey, fileName) { $.each(LinkData.getSubjects(workId, fileName), function(subKey, subValue) { if (self._isOctamerSubject(subValue)) { var triples = LinkData.getTriplesBySubject(workId, fileName, subValue); var seqEl = self._getObjectByTriple(triples); var seq = seqEl.getSequence(); if (seq && seq.trim().length != 0) { seqEl.setExternalUrl(subValue); //obj.url = subValue; self._octamerMap[seq] = seqEl; } } }); }); }); }, _getObjectByTriple : function(triples) { var self = this; //var obj = {}; var seqEl = new Application.seqElement(); $.each(triples, function(key, value) { var property = value.property; if (property.indexOf(self._default.filterSequencePropertyPhrase) >= 0) { seqEl.setSequence(value.object); //obj.sequence = value.object; } else if (property.indexOf(self._default.filterAppropriatePosition) >= 0) { seqEl.setAppropriatePos(value.object); //obj.appropriatePos = value.object; } }); return seqEl; }, _isOctamerSubject : function(subject) { var self = this; if (!subject) { return false; } if (subject.indexOf(self._default.filterSubjectUrlPhrase) > -1) { return true; } return false; }, getBySequence : function(sequence) { return this._octamerMap[sequence]; } }; // Application.seqElement method Application.seqElement = function() { this._init.apply(this, arguments); }; Application.seqElement.prototype = { _externalUrl : null, _sequence : null, _appropriatePos : null, _init : function() {}, getExternalUrl : function() { return this._externalUrl; }, setExternalUrl : function(externalUrl) { this._externalUrl = externalUrl; }, getSequence : function() { return this._sequence; }, setSequence : function(sequence) { this._sequence = sequence; }, getAppropriatePos : function() { return this._appropriatePos; }, setAppropriatePos : function(appropriatePos) { this._appropriatePos = appropriatePos; } }; // Main function $(document).ready(function() { var containerId = "container"; // Set work ID, file name, and base sequence var options = { workId : "rdf1s288i", fileName : "DiurnalHours_ATTED_COL_LDHH", baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" }; // Application.motifMinCircadian method new Application.motifMinCircadian(containerId, options); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 125px; } .row { padding: 5px 0; } .row:after { content: ""; clear: left; display: block; } .row input[type="text"] { width: 200px; } .highlight-sequence { font-weight: bold; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; word-wrap: break-word; } .replaceSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; } .replace { color: #E80010; } .errorMessage { color: #FF0000; text-align: center; } /** * button css */ .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .basePairs, .motifViewDialog .extraCopies, .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; }
<div id="container"></div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
GenoCon2 Challenge A - Circadian Coexpression (DIURNAL + ATTED-II promoter motif)
Contributor:GenoCon
Update:Sep 19, 2012
9089 Downloads, 10 Applications
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the CEG motifs as calculated by ATTED-II. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a>
DiurnalHours_ATTED_COL_LDHH
DiurnalHours_ATTED_COL_SD
DiurnalHours_ATTED_DD_DDHC
DiurnalHours_ATTED_LDHC
DiurnalHours_ATTED_LDHH_SM
DiurnalHours_ATTED_LDHH_ST
DiurnalHours_ATTED_LER_SD
DiurnalHours_ATTED_LIGHT5_HIF138_13
DiurnalHours_ATTED_LIGHT5_HIF138_8
DiurnalHours_ATTED_LIGHT5_znknOX
DiurnalHours_ATTED_LL12_LDHH
DiurnalHours_ATTED_LL23_LDHH
DiurnalHours_ATTED_LLHC
DiurnalHours_ATTED_LL_LDHC
DiurnalHours_ATTED_LL_LLHC
DiurnalHours_ATTED_lhyox_SD
DiurnalHours_ATTED_longday
DiurnalHours_ATTED_lux_2_LDHH
DiurnalHours_ATTED_phyB9_SD
DiurnalHours_ATTED_shortday
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s107i?tab=readme
Initial content
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
Work
Add
Clear
insert work id or work name.