MotifMaxExpress2 = function(containerId, options) {
	new Application.motifMax(containerId, options);
};

if (Application === "undefined" || !Application) {
	var Application = {};
}

Application.motifMax = function() {
	this._init.apply(this, arguments);
};

Application.motifMax.prototype = {
	
	_containerId : null,
	_baseSequence : null,
	_options : null,
	_motifProperty : null,
	_heptamer : null,
	_octamer : null,
	_appSequence : null,
	_filteredSubjectList : null,
	_motifViewDialogId : null,
	_geneInfoContainerId : null,
	
	_default : {
		appName : "MotifMaxExpress2",
		selectPropertyCaption : "Select Property",
		selectPropertyAreaClass : "selectPropertyArea",
		selectPropertyClass : "selectProperty",
		resultAreaClass : "resultArea",
		replaceButtonAreaClass : "replaceButtonArea",
		replaceButtonClass : "replaceButton",
		nextButtonAreaClass : "nextButtonArea",
		replaceSequenceClass : "replaceSequence",
		errorMessageAreaClass : "errorMessage",
		dialogErrorMessageClass : "dialogErrorMessage",
		dialogOutRangeValueMessage : "Please input a value between {0} and {1}",
		databaseInfoClass : "databaseInfo",
		geneLabelClass : "geneUrl",
		geneInfoLinkClass : "geneInfoLink",
		motifSequenceProperty : "motif sequence",
		motifPositionProperty : "motif position",
		typeProperty : "type",
		validType : "REG",
		motifViewDialogId : "motifViewDialog",
		motifViewDialogClass : "motifViewDialog",
		motifViewDialogTitle : "Motif View",
		minSequenceClass : "minSeq",
		maxSequenceClass : "maxSeq",
		websiteNameAtted : "ATTED",
		websiteNamePpdb : "PPDB",
		baseSequenceMinLength : 50,
		dialogImageUrl : "http://app.linkdata.org/asset/a06f4de4.png",
		callback : function() {},
		loadingImageContainer : "loadingImageContainer",
		loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif",
		loadingMessageClass : "loadingMessage",
		loadingMessage : "Loading linked data, it may take a few minutes..."
	},
	
	_tag : {
		topResult : "result_top",
		bottomResult : "result_bottom"
	},
	
	_init : function(containerId, options) {
		this._containerId = containerId;
		this._options = $.extend({}, this._default, options);
		this._baseSequence = this._options.baseSequence;
		this.filteredSubjectList = [];
		var date = new Date();
		this._geneInfoContainerId = "gene_info_containerId_" + date.getTime();
		this._initMotifProperty(this._options);
		this._initAppSequence(this._options);
		this._initHeptamer();
		this._initOctamer();
		this._initView();
		this._initMotifViewDialog();
	},
	
	_initMotifProperty : function(opts) {
		var obj = {
			workId : opts.workId,
			fileName : opts.fileName
		};
		this._motifProperty = new Application.motifProperty(obj);
	},
	
	_initAppSequence : function(opts) {
		var self = this;
		var timer = new Application.timer();
		var init = function() {
			var seqProperty = self._motifProperty.getPropertyByLabel(self._options.motifSequenceProperty);
			var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty);
			if (seqProperty && posProperty) {
				var obj = {
					workId : opts.workId,
					fileName : opts.fileName,
					baseSequence : self._baseSequence,
					motifSequenceProperty : seqProperty,
					motifPositionProperty : posProperty,
					containerId : self._containerId,
					errorMessageClass : self._options.errorMessageAreaClass,
					baseSequenceMinLength : self._options.baseSequenceMinLength
				};
				self._appSequence = new Application.sequence(obj);
			} else {
				timer.call(init);
			}
		}
		init();
	},
	
	_initHeptamer : function() {
		this._heptamer = new Application.heptamer();
	},
	
	_initOctamer : function() {
		this._octamer = new Application.octamer();
	},
	
	_initView : function() {
		this._initMainView();
		this._initDialogView();
	},
	
	_initMainView : function() {
		var self = this;
		var timer = new Application.timer();
		var fillOptionMethod = function() {
			var optionArray = self._motifProperty.getOptionArray();
			if (optionArray) {
				var sb = [];
				sb[sb.length] = "<div class='" + self._options.selectPropertyAreaClass + " row'>";
				sb[sb.length] = "<div class='label left'>" + self._options.selectPropertyCaption + "</div>";
				sb[sb.length] = "<div class='left'>";
				sb[sb.length] = "<select class='" + self._options.selectPropertyClass + "'>";
				sb[sb.length] = "<option value='" + -1 + "'>-- Select Property --</option>";
				$.each(optionArray, function(key, obj) {
					sb[sb.length] = "<option value='" + obj.key + "'>" + obj.value + "</option>";
				});
				sb[sb.length] = "</select>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>";
				sb[sb.length] = "<div id='" + self._geneInfoContainerId + "'></div>";
				sb[sb.length] = "<div class='" + self._options.resultAreaClass + " hidden'></div>";
				sb[sb.length] = "<div class='" + self._options.errorMessageAreaClass + " hidden'>error</div>";
				sb[sb.length] = "<div class='" + self._options.replaceButtonAreaClass + " hidden'>";
				sb[sb.length] = "<a class='" + self._options.replaceButtonClass + " btn btn-lightblue'>Replace</a>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "<div class='" + self._options.replaceSequenceClass + " hidden'></div>";
				sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>";
				sb[sb.length] = "<div class='" + self._options.loadingMessageClass + "'>" + self._options.loadingMessage + "</div>";
				sb[sb.length] = "<div>";
				sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>";
				sb[sb.length] = "</div>";
				sb[sb.length] = "</div>";
				$("#" + self._containerId).html(sb.join(""));
				self._initSelectPropertyListener();
			} else {
				timer.call(fillOptionMethod);
			}
		}
		fillOptionMethod();
	},
	
	_initDialogView : function() {
		var sb = [], self = this, date = new Date(); 
		this._motifViewDialogId = "motifViewDialog_id_" + self._containerId + "_" + date.getTime();
		sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden'>";
		sb[sb.length] = "<input type='hidden' class='sequence'>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span>Place motif at position</span>";
		sb[sb.length] = "<input type='text' class='position'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span class='explanation'>Replace with prefer position between ";
		sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>";
		sb[sb.length] = "</span>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span>Number of extra copies</span>";
		sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span>Space between copies (Base Pairs)</span>";
		sb[sb.length] = "<input type='text' class='basePairs' value='0'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='motifImageArea'>";
		sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span class='explanation'>Click ";
		sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website";
		sb[sb.length] = "</span>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div>";
		sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "</div>";
		$("#" + this._containerId).append(sb.join(""));
	},
	
	_initSelectPropertyListener : function() {
		var self = this, workId = self._options.workId, fileName = self._options.fileName;
		var timer = new Application.timer();
		var setSelectListener = function() {
			if ($("#" + self._containerId + " ." + self._options.selectPropertyClass).length != 0) {
				$("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() {
					$("#" + self._containerId + " ." + self._options.loadingImageContainer).show();
					self._appSequence.hideError();
					$("#" + self._containerId + " ." + self._options.resultAreaClass).hide();
					$("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide();
					$("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide();
					$("#" + self._containerId + " ." + self._options.databaseInfoClass).hide();
					$("#" + self._containerId + " #" + self._geneInfoContainerId).hide();
					var propLabel = $("option:selected", this).val();
					self._showMotifMaxSequence(workId, fileName, propLabel);
				});
			} else {
				timer.call(setSelectListener);
			}
		}
		setSelectListener();
	},
	
	_showGenePlot : function(subject, property) {
		var self = this;
		$("#" + self._containerId + " #" + self._geneInfoContainerId).show();
		var options = {
			workId : self._options.workId,
			fileName : self._options.fileName,
			subject : subject,
			property : property
		};
		new Application.geneChart(self._geneInfoContainerId, options);
	},
	
	_showDataBaseInformationList : function() {
		var self = this, seqVal = [];
		$("#" + self._containerId + " .userSequence .hdnSequence").each(function() {
			var tmpPos = $(this).siblings(".hdnPosition").val();
			seqVal.push($(this).val() + "[" + tmpPos + "]");
		});
		self._showDatabaseInfo(seqVal.join(", "));
	},
	
	_initReplaceButtonLitener : function() {
		var self = this, workId = self._options.workId, fileName = self._options.fileName;
		$("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() {
			self._appSequence.hideError();
			$("#" + self._containerId + " ." + self._options.replaceSequenceClass).show();
			var seqs = [];
			$("#" + self._containerId + " .userSequence").each(function() {
				seqs.push($(this).text());
			});
			var html = self._appSequence.replace(seqs);
			$("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html);
			self._showDataBaseInformationList();
			self._options.callback();
		});
	},
	
	_initMotifSequenceListener : function() {
		var self = this;
		$("#" + self._containerId + " .motifSequence").click(function() {
			$("." + self._options.motifViewDialogClass).hide();
			var parent = $(this).closest('.userSequence');
			var container = $(this).closest('.userSequence');
			var seq = $(parent).find(".hdnSequence").val();
			var pos = $(parent).find(".hdnPosition").val();
			var seqEl = self._getSeqElBySeq(seq);
			var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos;
			self._initSequencePopup(seqEl);
			$("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide();
			$("#" + self._motifViewDialogId + " .sequence").val(seq);
			$("#" + self._motifViewDialogId + " .position").val(appropriatePos);
			$("#" + self._motifViewDialogId + " .extraCopies").val(0);
			$("#" + self._motifViewDialogId + " .basePairs").val(0);
			$("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq));
			$("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq));
			self._initPositionInsert(seq, appropriatePos);
			$("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq});
			$("#" + self._motifViewDialogId).dialog("open");
			$("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show();
		});
	},
	
	_initSequencePopup : function(seqEl) {
		var self = this;
		$("#" + self._motifViewDialogId + " .moreInfo").unbind("click");
		var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#";
		$("#" + self._motifViewDialogId + " .moreInfo").click(function() {
			self._showPopupWindow(url);
		});
	},
	
	_showPopupWindow : function(url) {
		var winWidth = 800;
		var winHeight = 800;
		var winLeft = parseInt((screen.availWidth/2) - (winWidth/2));
		var winTop = parseInt((screen.availHeight/2) - (winHeight/2));
		var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1";
		window.open(url, "Motif", winStyle);
	},
	
	_initPositionInsert : function(seq, pos) {
		var self = this;
		var mod = seq.length % 2;
		$("#" + self._motifViewDialogId + " .position").unbind("keyup");
		$("#" + self._motifViewDialogId + " .position").keyup(function() {
			var val = $(this).val();
			if (isNaN(val)) {
				$(this).val(pos);
				return;
			}
			var tmpVal = new String(val);
			if (mod == 0) {
				if (tmpVal.indexOf(".") == -1) {
					$(this).val(tmpVal + ".5");
				} else {
					$(this).val(tmpVal.split(".")[0] + ".5");
				}
			} else {
				if (tmpVal.indexOf(".") > -1) {
					$(this).val(tmpVal.split(".")[0]);
				}
			}
		});
	},
	
	_initMotifViewDialog : function() {
		var self = this;
		$("#" + self._motifViewDialogId).dialog({
			autoOpen: false,
			title: self._default.motifViewDialogTitle,
			width: 520,
			dialogClass : self._options.motifViewDialogClass,
			buttons : [
				{
					text: "Replace",
					click : function() {
						var seq = $("#" + self._motifViewDialogId).find(".sequence").val();
						var pos = $("#" + self._motifViewDialogId).find(".position").val();
						var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val());
						var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val());
						var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html());
						var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html());
						if (minPos > pos || maxPos < pos) {
							$dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass);
							$dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos));
							$dialogError.show();
							return;
						}
						self._appSequence.hideError();
						self._replaceWithSequence(seq, pos, extraCopies, basePairs);
						$(this).dialog("close");
					}
				},
				{
					text: "Cancel",
					click : function() {
						$(this).dialog("close");
					}
				}
			]
		});
	},
	
	_getMotifMaxTriple : function(workId, fileName, property) {
		var self = this;
		var index = new Application.index(1, 8000);
		var maxTriple;
		var getTriplesByProperty = function(tripleList) {
			var maxIndex = -1;
			var maxValue = -99999;
			$.each (tripleList, function(tKey, tValue) {
				var tmpValue = parseFloat(tValue.object);
				if (Math.max(tmpValue, maxValue) != maxValue) {
					maxValue = tmpValue;
					maxIndex = tKey;
				}
			});
			if (maxIndex != -1) {
				if (!maxTriple) {
					maxTriple = tripleList[maxIndex];
				}
				var tmpMaxValue = parseFloat(maxTriple.object);
				var currentValue = parseFloat(tripleList[maxIndex].object);
				if (Math.max(tmpMaxValue, currentValue) != tmpMaxValue) {
					maxTriple = tripleList[maxIndex];
				}	
			}
			if (tripleList && tripleList.length == index.getItemCount()) {
				LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.increment());
			} else {
				self._motifMaxSequence(workId, fileName, maxTriple.subject, property);
			}
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.getIndex());
	},
	
	_showMotifMaxSequence : function(workId, fileName, propLabel) {
		var self = this, foundTopFile = false;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(wId, fileList) {
				$.each(fileList, function(fileKey, fName) {
					var tmpName = fName.split("_top");
					if (fileName.indexOf(tmpName[0]) > -1) {
						self._getTopFilePropertyList(workId, fileName, wId, fName, propLabel);
						foundTopFile = true;
						return false;
					}
				});
			});
			if (!foundTopFile) {
				var property = self._motifProperty.getPropertyByLabel(propLabel);
				self._getMotifMaxTriple(workId, fileName, property);
			}
		}
		LinkData.getFilesByTag(null, self._tag.topResult, getFilesByTag);
	},
	
	_getTopFilePropertyList : function(workId, fileName, topWorkId, topFileName, propLabel) {
		var self = this;
		var getProperties = function(propList) {
			$.each(propList, function(propKey, propValue) {
				var tmpProperty = self._motifProperty._getLabel(propValue);
				if (tmpProperty.indexOf(propLabel) > -1) {
					var property = self._motifProperty.getPropertyByLabel(propLabel);
					self._showMotifMax(workId, fileName, property, topWorkId, topFileName, propValue);
					return false;
				}
			});
		}
		LinkData.getProperties(topWorkId, topFileName, getProperties);
	},
	
	_showMotifMax : function(workId, fileName, property, topWorkId, topFileName, topProperty) {
		var self = this;
		var index = new Application.index(1, 1000);
		var getTriplesByProperty = function(tripleList) {
			self._showMotifMaxByTripleList(workId, fileName, property, tripleList);
		}
		LinkData.getTriplesByProperty(topWorkId, topFileName, topProperty, getTriplesByProperty, index.getIndex());
	},
	
	_showMotifMaxByTripleList : function(workId, fileName, property, tripleList) {
		var self = this, i = 0, subject = tripleList[i].object;
		var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty);
		var showMaxMotif = function(posTripleList) {
			var found = false;
			i++;
			$.each(posTripleList, function(pKey, pValue) {
				var tmpPos = parseInt(pValue);
				if (self._options.baseSequenceMinLength < tmpPos && self._options.baseSequence.length >= tmpPos) {
					found = true;
					self._motifMaxSequence(workId, fileName, subject, property);
					return false;
				}
			});
			if (! found) {
				subject = tripleList[i].object;
				LinkData.getObjects(workId, fileName, subject, posProperty, showMaxMotif);
			}
		}
		LinkData.getObjects(workId, fileName, subject, posProperty, showMaxMotif);
	},
	
	_getDataBaseWebsiteName : function() {
		var self = this;
		var fileName = self._options.fileName
		if (fileName.indexOf(self._options.websiteNameAtted) > -1) {
			return self._options.websiteNameAtted;
		} else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) {
			return self._options.websiteNamePpdb;
		} else {
			return "UNKNOWN";
		}
	},
	
	_motifMaxSequence : function(workId, fileName, subject, property) {
		var self = this;
		var drawSequence = function(seqHtml) {
			var sb = [];
			sb[sb.length] = "<input type='hidden' class='" + self._default.geneLabelClass + "' value='" + subject + "'/>";
			sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>";
			sb[sb.length] = seqHtml;
			$("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join(""));
			if (seqHtml.length == 0) {
				$("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide();
			}
			self._initMotifSequenceListener();
			self._initReplaceButtonLitener();
			self._showDataBaseInformationList();
			self._showGenePlot(subject, property);
			$("#" + self._containerId + " ." + self._options.resultAreaClass).show();
			$("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show();
			$("#" + self._containerId + " ." + self._options.loadingImageContainer).hide();
		}
		self._appSequence.getSequenceHtml(subject, drawSequence);
	},
	
	_getMinPosition : function(seq) {
		var self = this;
		var mod = seq.length % 2;
		var tHold = (mod == 1) ? 1 : 0.5;
		return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold;
	},
	
	_getMaxPosition : function(seq) {
		var self = this;
		var mod = seq.length % 2;
		var tHold = (mod == 1) ? 0 : 0.5;
		return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold;
	},
	
	_getSeqElBySeq : function(seq) {
		if (seq && seq.trim().length == 7) {
			return this._heptamer.getBySequence(seq);
		} else if (seq && seq.trim().length == 8) {
			return this._octamer.getBySequence(seq);
		}
	},
	
	_showDatabaseInfo : function(seqVal) {
		var self = this, fileName = self._options.fileName, appName = self._options.appName;
		var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val();
		var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val();
		var label = self._motifProperty._getDisplayLabel(propLabel);
		label = (label && label.trim().length != 0) ? label : propLabel;
		var usedMotif = (seqVal.length != 0) ? seqVal : "-";
		var dbInfoHtml = self._getDatabaseInfo(fileName, appName, subject, label, usedMotif);
		$("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml);
		$("#" + self._containerId + " ." + self._options.databaseInfoClass).show();
		self._genePreviewListener(subject);
	},
	
	_genePreviewListener : function(subject) {
		var self = this;
		$("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() {
			self._showPopupWindow(subject);
		});
	},
	
	_getDatabaseInfo : function(fileName, method, subject, property, motif) {
		var self = this;
		var gene = self._motifProperty.getGeneBySubject(subject);
		var sb = [];
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Database</div>";
		sb[sb.length] = "<div class='left'>" + fileName + "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Application</div>";
		sb[sb.length] = "<div class='left'>" + method + "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Gene Locus</div>";
		sb[sb.length] = "<div class='left'><a href='javascript:void(0);' class='" + self._options.geneInfoLinkClass + "'>" + gene + "</a></div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Property</div>";
		sb[sb.length] = "<div class='left'>" + property + "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Motif</div>";
		sb[sb.length] = "<div class='left motif'>" + motif + "</div>";
		sb[sb.length] = "</div>";
		return sb.join("");
	},
	
	_replaceWithSequence : function(seq, pos, extraCopies, basePairs) {
		var self = this;
		var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs);
		$("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html);
		$("#" + self._containerId + " ." + self._options.replaceSequenceClass).show();
		var seqLabel = seq + "[" + pos + "]";
		self._showDatabaseInfo(seqLabel);
		self._options.callback();
	}
	
};

Application.geneChart = function() {
	this._init.apply(this, arguments);
};

Application.geneChart.prototype = {
	
	_containerId : null,
	_options : null,
	_workId : null,
	_fileName : null,
	_subject : null,
	_property : null,
	_highChartContainerId : null,
	_appProperty : null,
	
	_default : {
		filterNamespace : "http://linkdata.org/",
		acceptPropLabelPrefix : "label:"
	},
	
	_init : function(containerId, options) {
		this._containerId = containerId;
		this._options = $.extend({}, this._default, options);
		this._workId = this._options.workId;
		this._fileName = this._options.fileName;
		this._subject = this._options.subject;
		this._property = this._options.property;
		var date = new Date();
		this._highChartContainerId = "gene_chart_" + date.getTime();
		this._initAppProperty(this._options);
		this._initView();
		this._drawHighChart(this._subject, this._property);
	},
	
	_initAppProperty : function(opts) {
		var obj = {
			workId : opts.workId,
			fileName : opts.fileName
		};
		this._appProperty = new Application.motifProperty(obj);
	},
	
	_initView : function() {
		var self = this;
		var sb = [];
		sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>";
		$("#" + self._containerId).html(sb.join(""));
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_drawHighChart : function(subject, highlightProperty) {
		var self = this;
		var getDataArray = function(tripleList) {
			var dataArray = [];
			var dataObject = {};
			var array = [];
			var duplicateProperty = [];
			$.each (tripleList, function(tKey, tValue) {
				var property = tValue.property;
				if (property.indexOf(self._options.filterNamespace) == -1) {
					return;
				}
				if ($.inArray(property, duplicateProperty) > -1) {
					return;
				}
				var label = self._getLabelAfterHash(property);
				if (!self._ignore(label)) {
					var val = parseFloat(tValue.object);
					if (highlightProperty === property) {
						val = self._getHighLightColumn(parseFloat(tValue.object));
					}
					array.push(val);
					duplicateProperty.push(property);
				}
			});
			dataObject.name = self._getLabel(subject);
			dataObject.data = array;
			dataArray.push(dataObject);
			self._getXCategory(tripleList, dataArray, highlightProperty);
		}
		LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray);
	},
	
	_getXCategory : function(tripleList, dataArray, highlightProperty) {
		var self = this;
		var array = [];
		var duplicateProperty = [];
		var hLabel = self._getLabelAfterHash(highlightProperty);
		$.each (tripleList, function(tKey, tValue) {
			var property = tValue.property;
			if (property.indexOf(self._options.filterNamespace) == -1) {
				return;
			}
			if ($.inArray(property, duplicateProperty) > -1) {
				return;
			}
			var label = self._getLabelAfterHash(property);
			if (!self._ignore(label)) {
				var displayLabel = self._getDisplayLabel(label);
				var hDisplayLabel = self._getDisplayLabel(hLabel);
				if (displayLabel === hDisplayLabel) {
					displayLabel = "<span style=\"color:#FB3B44\">" + hDisplayLabel + "</span>";
				}
				array.push(displayLabel);
				duplicateProperty.push(property);
			}
		});
		self._drawChart(self._highChartContainerId, dataArray, array);
	},
	
	_getHighLightColumn : function(val) {
		var obj = {};
		obj.y = val;
		obj.marker = {
			lineWidth: 3,
			lineColor: "#FB3B44",
			fillColor: "#FB3B44"
		};
		return obj;
	},
	
	_drawChart : function(containerId, dataArray, xCategory) {
		var self = this;
		var chart = new Highcharts.Chart({
			chart: {
				renderTo: containerId,
				type: 'line',
				marginRight: 130,
				marginBottom: 125
			},
			title: {
				text: self._fileName
			},
			xAxis: {
				categories: xCategory,
				labels : {
					rotation: 315
				}
			},
			tooltip: {
				formatter: function() {
					return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']';
				}
			},
			legend: {
				layout: 'vertical',
				align: 'right',
				verticalAlign: 'top',
				x: -10,
				y: 100,
				borderWidth: 0
			},
			series: dataArray
 		});
	},
	
	_getLabel : function(value) {
		var self = this, label;
		if (value.indexOf("#") > -1) {
			label = self._getLabelAfterHash(value);
		} else {
			label = self._appProperty.getGeneBySubject(value);
		}
		if (!label) {
			label = value;
		}
		return label;
	},
	
	_getPropertyLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
			propLabel = this._appProperty.getPropertyNameByLabel(propLabel);
		}
		return propLabel;
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
	
};

Application.motifProperty = function() {
	this._init.apply(this, arguments);
};

Application.motifProperty.prototype = {

	_options : null,
	_propMap : null,
	_nameMap : null,
	_optionArray : null,
	
	_default : {
		acceptPropLabelPrefix : "label:",
		subjectATTEDUriPhrase : "http://atted.jp/data/locus/",
		subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene="
	},
	
	_init : function(options) {
		this._options = $.extend({}, this._default, options);
		this._propMap = [];
		this._nameMap = [];
		this._initPropMap(this._options);
	},
	
	_initPropMap : function(opts) {
		var self = this, workId = opts.workId, fileName = opts.fileName;
		var method = function(properties) {
			self._fillPropMap(self, properties);
			self._initOptionArray(properties);
		}
		LinkData.getProperties(workId, fileName, method);
	},
	
	_fillPropMap : function(self, properties) {
		$.each(properties, function(key, value) {
			var label = self._getLabel(value);
			if (!self._propMap[label]) {
				self._propMap[label] = value;
			}
		});
	},
	
	_initOptionArray : function(propertyList) {
		var self = this, list = new Object();
		var workId = self._options.workId, fileName = self._options.fileName;
		self._optionArray = [];
		$.each(propertyList, function(key, value) {
			var propLabel = self._getLabel(value);
			if (!self._ignore(propLabel)) {
				var obj = {};
				obj.key = propLabel;
				obj.value = self._getDisplayLabel(propLabel);
				self._optionArray.push(obj);
			}
		});
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_getLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},

	getOptionArray : function() {
		return this._optionArray;
	},
	
	getPropertyByLabel : function(label) {
		return this._propMap[label];
	},
	
	getGeneBySubject : function(subject) {
		var self = this, htmlExt = ".html", geneLabel;
		if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, "");
		} else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, "");
		}
		if (geneLabel && geneLabel.indexOf(htmlExt) > -1) {
			geneLabel = geneLabel.replace(htmlExt, "");
		}
		return geneLabel;
	}
	
};

Application.sequence = function() {
	this._init.apply(this, arguments);
};

Application.sequence.prototype = {
	
	CHAR_SEQ_EMPTY : "-",
	
	_options : null,
	_workId : null,
	_fileName : null,
	_seqProperty : null,
	_posProperty : null,
	_baseSequence : null,
	_sequenceList : null,
	_positionList : null,
	_containerId : null,
	_errorContainerClass : null,
	_outOfRangeArray : null,
	
	_default : {
		msgInvalidSequence: "invalid sequence.",
		msgOutOfRangeSequence: "out of range sequence : {0}",
	},
	
	_init : function(options) {
		this._options = options;
		this._workId = this._options.workId;
		this._fileName = this._options.fileName;
		this._seqProperty = this._options.motifSequenceProperty;
		this._posProperty = this._options.motifPositionProperty;
		this._baseSequence = this._options.baseSequence;
		this._containerId = this._options.containerId;
		this._errorContainerClass = this._options.errorMessageClass;
	},
	
	_getCustomSequenceHtml : function(baseSequence, sequence, position) {
		var seqLen = sequence.length;
		var tHold = Math.floor(seqLen / 2) + 1;
		var pos = parseInt(position);
		var baseSeqLen = baseSequence.length;
		var suffixLen = baseSeqLen - tHold - pos;
		var sb = [];
		if (pos > this._options.baseSequenceMinLength && suffixLen > 0) {
			for (var i = 0; i < suffixLen; i++) {
				sb.push(this.CHAR_SEQ_EMPTY);
			}
			sb.push("<a href='javascript:void(0)' class='motifSequence'>" + sequence + "</a>");
			sb.push("<input type='hidden' class='hdnSequence' value='" + sequence + "'/>");
			sb.push("<input type='hidden' class='hdnPosition' value='" + pos + "'/>");
		} else {
			//_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence));
			this._outOfRangeArray.push(sequence + "[" + pos + "]");
			this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.join(", ")));
		}
		return sb.join("");
	},
	
	_isValidSequenceList : function(seqs) {
		var count = seqs.length;
		var maxlength = 0;
		for (var i = 0; i < count; i++) {
			if (seqs[i].length > maxlength) {
				maxlength = seqs[i].length;
			}
		}
		var result = true;
		for (var i = 0; i < maxlength; i++) {
			var chars = [];
			for (var j = 0; j < count; j++) {
				chars.push(seqs[j].charAt(i));
			}
			if (! this._isValidChars(chars.join(""))) {
				result = false;
				break;
			}
		}
		return result;
	},
	
	_isValidChars : function(charString) {
		var charLen = charString.length;
		var result = true;
		var first = null;
		for (var i = 0; i < charLen; i++) {
			if (charString.charAt(i) == this.CHAR_SEQ_EMPTY) {
				continue;
			}
			if (! first) {
				first = charString.charAt(i);
			}
			var current = charString.charAt(i);
			if (current && first != current) {
				result = false;
				break;
			}
		}
		return result;
	},
	
	_getReplacedCustomSequence : function(seqs) {
		var mergeSequence = this._getmergeCharSequence(seqs);
		var maxlength = this._baseSequence.length;
		
		var sb = [];
		for (var i = 0; i < maxlength; i++) {
			var bChar = this._baseSequence.charAt(i);
			var mChar = mergeSequence.charAt(i);
			if (mChar !== this.CHAR_SEQ_EMPTY) {
				// replaced
				sb.push(mChar);
			} else {
				sb.push(bChar);
			}
		}
		
		return sb.join("");
	},
	
	_getmergeCharSequence : function(seqs) {
		var count = seqs.length;
		var maxlength = this._baseSequence.length;
		var sb = [];
		for (var i = 0; i < maxlength; i++) {
			var chars = [];
			for (var j = 0; j < count; j++) {
				chars.push(seqs[j].charAt(i) ? seqs[j].charAt(i) : this.CHAR_SEQ_EMPTY);
			}
			sb.push(this._getMergeChar(chars.join("")));
		}
		return sb.join("");
	},
	
	_getMergeChar : function(charString) {
		var charLen = charString.length;
		var result = null;
		for (var i = 0; i < charLen; i++) {
			if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) {
				result = charString.charAt(i);
				break;
			}
		}
		if (!result) {
			result = this.CHAR_SEQ_EMPTY;
		}
		return result;
	},
	
	_wrappedReplacedSequenceHtml : function(replaceSequence, seqs) {
		var mergeSequence = this._getmergeCharSequence(seqs);
		var length = this._baseSequence.length;
		var sb = [];
		for (var i = 0; i < length; i++) {
			var bChar = this._baseSequence.charAt(i);
			var rChar = replaceSequence.charAt(i);
			var mChar = mergeSequence.charAt(i);
			var seqChar = (bChar !== rChar) ? "<span class='replace'>" + rChar + "</span>" : rChar;
			if (mChar !== this.CHAR_SEQ_EMPTY) {
				sb.push("<span class='highlight-sequence'>" + seqChar + "</span>");
			} else {
				sb.push(seqChar);
			}
		}
		return sb.join("");
	},
	
	_showError : function(message) {
		$errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass);
		$errorMessageContainer.html(message);
		$errorMessageContainer.show();
	},
	
	getSequenceHtml : function(subject, drawSequence) {
		var self = this;
		self._outOfRangeArray = [];
		var sb = [], baseSequence = self._baseSequence;
		var getTriplesBySequenceProperty = function(sequenceList) {
			self._getTriplesBySequenceProperty(subject, drawSequence, sequenceList);
		}
		LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty, getTriplesBySequenceProperty);
	},
	
	_getTriplesBySequenceProperty : function(subject, drawSequence, sequenceList) {
		var self = this;
		var getTriplesByPositionProperty = function(positionList) {
			self._drawSequenceList(drawSequence, sequenceList, positionList);
		}
		LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty, getTriplesByPositionProperty);
	},
	
	_drawSequenceList : function(drawSequence, sequenceList, positionList) {
		var self = this, sb = [];
		if (!sequenceList || sequenceList.length == 0) {
			return;
		}
		for (var i = 0; i < sequenceList.length; i++) {
			var customSeqString = self._getCustomSequenceHtml(self._baseSequence, sequenceList[i], positionList[i]);
			if (customSeqString.length > 0) {
				sb.push("<div class='userSequence'>" + customSeqString + "</div>");
			}
		}
		drawSequence(sb.join("\n"));
	},
	
	replace : function(seqs) {
		var isValid = this._isValidSequenceList(seqs);
		if (isValid) {
			if (seqs.length > 0) {
				var replaceSeq = this._getReplacedCustomSequence(seqs);
				var replaceSeqHtml = this._wrappedReplacedSequenceHtml(replaceSeq, seqs);
				return replaceSeqHtml;
			}
		} else {
			this._showError(this._default.msgInvalidSequence);
		}
	},
	
	replaceWith : function(seq, pos, extraCopies, basePairs) {
		var main = [];
		var seqLen = seq.length;
		var tHold = Math.floor(seqLen / 2) + 1;
		var pos = parseInt(pos);
		var baseSeqLen = this._baseSequence.length;
		var len = baseSeqLen - tHold - pos;
		for (var j = 0; j < extraCopies + 1; j++) {
			var array = [];
			for (var i = 0; i < len; i++) {
				array.push(this.CHAR_SEQ_EMPTY);
			}
			array.push(seq);
			main.push(array.join(""));
			len = len - seqLen - basePairs;
			if (len < 0) {
				break;
			}
		}
		return this.replace(main);
	},
	
	hideError : function() {
		$errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide();
	}
	
};

Application.heptamer = function() {
	this._init.apply(this, arguments);
};

Application.heptamer.prototype = {
	
	_heptamerMap : null,
	_motifSequenceProperty : null,
	_appropriatePositionProperty : null,
	
	_default : {
		heptamerTag : "heptamer",
		filterSequencePropertyPhrase : "motif_sequence",
		filterMaxCEGPropertyPhrase : "maxCEG",
		filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)"
	},
	
	_init : function() {
		this._heptamerMap = [];
		this._initHeptamerList();
	},
	
	_initHeptamerList : function() {
		var self = this;
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initHeptamer(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._default.heptamerTag, getFilesByTag);
	},
	
	_initHeptamer : function(workId, fileName) {
		var self = this;
		var getPropertyList = function(propertyList) {
			self._initProperty(propertyList);
			self._getSequenceTriple(workId, fileName);
		}
		LinkData.getProperties(workId, fileName, getPropertyList);
	},
	
	_initProperty : function(propertyList) {
		var self = this;
		$.each(propertyList, function(propKey, propValue) {
			if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) {
				self._motifSequenceProperty = propValue;
			} else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) {
				self._appropriatePositionProperty = propValue;
			}
		});
	},
	
	_getSequenceTriple : function(workId, fileName) {
		var self = this;
		var getSequenceTripleList = function(sequenceTripleList) {
			self._fillHeptamerMap(workId, fileName, sequenceTripleList);
		}
		LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList);
	},
	
	_fillHeptamerMap : function(workId, fileName, sequenceTripleList) {
		var self = this;
		var getPositionTripleList = function(positionTripleList) {
			for (var i = 0; i < sequenceTripleList.length; i++) {
				var seqTriple = sequenceTripleList[i];
				var posTriple = positionTripleList[i];
				var seqEl = new Application.seqElement();
				seqEl.setExternalUrl(seqTriple.subject);
				seqEl.setSequence(seqTriple.object);
				seqEl.setAppropriatePos(posTriple.object);
				self._heptamerMap[seqTriple.object] = seqEl;
			}
		}
		LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList);
	},
	
	getBySequence : function(sequence) {
		return this._heptamerMap[sequence];
	}
	
};

Application.octamer = function() {
	this._init.apply(this, arguments);
}

Application.octamer.prototype = {
	
	_octamerMap : null,
	_motifSequenceProperty : null,
	_appropriatePositionProperty : null,
	
	_default : {
		octamerTag : "octamer",
		filterSequencePropertyPhrase : "sequence",
		filterAppropriatePosition : "Appropriate%20position"
	},
	
	_init : function() {
		this._octamerMap = [];
		this._initOctamerList();
	},
	
	_initOctamerList : function() {
		var self = this;
		var getFilesByTag = function(result) {
			$.each(result, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._initOctamer(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, self._default.octamerTag, getFilesByTag);
	},
	
	_initOctamer : function(workId, fileName) {
		var self = this;
		var getProperties = function(propertyList) {
			self._initProperty(propertyList);
			self._getSequenceTriple(workId, fileName);
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_initProperty : function(propertyList) {
		var self = this;
		$.each(propertyList, function(propKey, propValue) {
			if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) {
				self._motifSequenceProperty = propValue;
			} else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) {
				self._appropriatePositionProperty = propValue;
			}
		});
	},
	
	_getSequenceTriple : function(workId, fileName) {
		var self = this;
		var getSequenceTripleList = function(sequenceTripleList) {
			self._fillOctamerMap(workId, fileName, sequenceTripleList);
		}
		LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList);
	},
	
	_fillOctamerMap : function(workId, fileName, sequenceTripleList) {
		var self = this;
		var getPositionTripleList = function(positionTripleList) {
			for (var i = 0; i < sequenceTripleList.length; i++) {
				var j = Math.floor(i / 2);
				var seqTriple = sequenceTripleList[i];
				var posTriple = positionTripleList[j];
				var seqEl = new Application.seqElement();
				seqEl.setExternalUrl(seqTriple.subject);
				seqEl.setSequence(seqTriple.object);
				seqEl.setAppropriatePos(posTriple.object);
				self._octamerMap[seqTriple.object] = seqEl;
			}
		}
		LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList);
	},
	
	getBySequence : function(sequence) {
		return this._octamerMap[sequence];
	}
	
};

Application.seqElement = function() {
	this._init.apply(this, arguments);
};

Application.seqElement.prototype = {
	
	_externalUrl : null,
	_sequence : null,
	_appropriatePos : null,
	
	_init : function() {},
	
	getExternalUrl : function() {
		return this._externalUrl;
	},

	setExternalUrl : function(externalUrl) {
		this._externalUrl = externalUrl;
	},
	
	getSequence : function() {
		return this._sequence;
	},
	
	setSequence : function(sequence) {
		this._sequence = sequence;
	},
	
	getAppropriatePos : function() {
		return this._appropriatePos;
	},
	
	setAppropriatePos : function(appropriatePos) {
		this._appropriatePos = appropriatePos;
	}
	
};

Application.timer = function() {
	this._init.apply(this, arguments);
};

Application.timer.prototype = {
	
	_delay : null,
	_retry : null,
	_maxRetry : null,
	
	_init : function() {
		this._delay = 1000;
		this._retry = 0;
		this._maxRetry = 100;
	},
	
	call : function(func) {
		if (this._retry < this._maxRetry) {
			setTimeout(func, this._delay);
		}
		this._retry++;
	}
};

Application.index = function() {
	this._init.apply(this, arguments);
}

Application.index.prototype = {
	
	_start : null,
	_end : null,
	
	_init : function(start, end) {
		this._start = start;
		this._end = end;
	},
	
	getIndex : function() {
		return {start : this._start, end : this._end};
	},
	
	getItemCount : function() {
		return (this._end - this._start + 1);
	},
	
	increment : function() {
		var itemCount = this.getItemCount();
		this._start = this._start + itemCount;
		this._end = this._end + itemCount;
		return {start : this._start, end : this._end};
	},
	
	getStartIndex : function() {
		return this._start;
	},
	
	getEndIndex : function() {
		return this._end;
	}
	
};

$(document).ready(function() {
	var fillDatabase = function(resultList) {
		$(".motifMaxDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>");
		$.each(resultList, function(workId, fileList) {
			$.each(fileList, function(fileKey, fileName) {
				$(".motifMaxDatabase").append("<option value='" + workId + "|" + fileName + "'>" + fileName + "</option>");
			});
		});
		$(".motifMaxDatabase").change(function() {
			var dbKey = $("option:selected", $(this)).val();
			if (dbKey == -1) {
				$("#container").html("");
				return;
			}
			var array = dbKey.split("|");
			var containerId = "container";
			var options = {
				workId : array[0],
				fileName : array[1],
				baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC"
			};
			new Application.motifMax(containerId, options);
		});
	}
	LinkData.getFilesByTag(null, "database", fillDatabase);
});