MotifMaxExpress2 = function(containerId, options) { new Application.motifMax(containerId, options); }; if (Application === "undefined" || !Application) { var Application = {}; } Application.motifMax = function() { this._init.apply(this, arguments); }; Application.motifMax.prototype = { _containerId : null, _baseSequence : null, _options : null, _motifProperty : null, _heptamer : null, _octamer : null, _appSequence : null, _filteredSubjectList : null, _motifViewDialogId : null, _geneInfoContainerId : null, _default : { appName : "MotifMaxExpress2", selectPropertyCaption : "Select Property", selectPropertyAreaClass : "selectPropertyArea", selectPropertyClass : "selectProperty", resultAreaClass : "resultArea", replaceButtonAreaClass : "replaceButtonArea", replaceButtonClass : "replaceButton", nextButtonAreaClass : "nextButtonArea", replaceSequenceClass : "replaceSequence", errorMessageAreaClass : "errorMessage", dialogErrorMessageClass : "dialogErrorMessage", dialogOutRangeValueMessage : "Please input a value between {0} and {1}", databaseInfoClass : "databaseInfo", geneLabelClass : "geneUrl", geneInfoLinkClass : "geneInfoLink", motifSequenceProperty : "motif sequence", motifPositionProperty : "motif position", typeProperty : "type", validType : "REG", motifViewDialogId : "motifViewDialog", motifViewDialogClass : "motifViewDialog", motifViewDialogTitle : "Motif View", minSequenceClass : "minSeq", maxSequenceClass : "maxSeq", websiteNameAtted : "ATTED", websiteNamePpdb : "PPDB", baseSequenceMinLength : 50, dialogImageUrl : "http://app.linkdata.org/asset/a06f4de4.png", callback : function() {}, loadingImageContainer : "loadingImageContainer", loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif", loadingMessageClass : "loadingMessage", loadingMessage : "Loading linked data, it may take a few minutes..." }, _tag : { topResult : "result_top", bottomResult : "result_bottom" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._baseSequence = this._options.baseSequence; this.filteredSubjectList = []; var date = new Date(); this._geneInfoContainerId = "gene_info_containerId_" + date.getTime(); this._initMotifProperty(this._options); this._initAppSequence(this._options); this._initHeptamer(); this._initOctamer(); this._initView(); this._initMotifViewDialog(); }, _initMotifProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._motifProperty = new Application.motifProperty(obj); }, _initAppSequence : function(opts) { var self = this; var timer = new Application.timer(); var init = function() { var seqProperty = self._motifProperty.getPropertyByLabel(self._options.motifSequenceProperty); var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); if (seqProperty && posProperty) { var obj = { workId : opts.workId, fileName : opts.fileName, baseSequence : self._baseSequence, motifSequenceProperty : seqProperty, motifPositionProperty : posProperty, containerId : self._containerId, errorMessageClass : self._options.errorMessageAreaClass, baseSequenceMinLength : self._options.baseSequenceMinLength }; self._appSequence = new Application.sequence(obj); } else { timer.call(init); } } init(); }, _initHeptamer : function() { this._heptamer = new Application.heptamer(); }, _initOctamer : function() { this._octamer = new Application.octamer(); }, _initView : function() { this._initMainView(); this._initDialogView(); }, _initMainView : function() { var self = this; var timer = new Application.timer(); var fillOptionMethod = function() { var optionArray = self._motifProperty.getOptionArray(); if (optionArray) { var sb = []; sb[sb.length] = "
"; sb[sb.length] = "
" + self._options.selectPropertyCaption + "
"; sb[sb.length] = "
"; sb[sb.length] = ""; sb[sb.length] = "
"; sb[sb.length] = "
"; sb[sb.length] = ""; sb[sb.length] = "
"; sb[sb.length] = ""; sb[sb.length] = ""; sb[sb.length] = ""; sb[sb.length] = ""; sb[sb.length] = ""; $("#" + self._containerId).html(sb.join("")); self._initSelectPropertyListener(); } else { timer.call(fillOptionMethod); } } fillOptionMethod(); }, _initDialogView : function() { var sb = [], self = this, date = new Date(); this._motifViewDialogId = "motifViewDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = ""; $("#" + this._containerId).append(sb.join("")); }, _initSelectPropertyListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var timer = new Application.timer(); var setSelectListener = function() { if ($("#" + self._containerId + " ." + self._options.selectPropertyClass).length != 0) { $("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() { $("#" + self._containerId + " ." + self._options.loadingImageContainer).show(); self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); $("#" + self._containerId + " #" + self._geneInfoContainerId).hide(); var propLabel = $("option:selected", this).val(); self._showMotifMaxSequence(workId, fileName, propLabel); }); } else { timer.call(setSelectListener); } } setSelectListener(); }, _showGenePlot : function(subject, property) { var self = this; $("#" + self._containerId + " #" + self._geneInfoContainerId).show(); var options = { workId : self._options.workId, fileName : self._options.fileName, subject : subject, property : property }; new Application.geneChart(self._geneInfoContainerId, options); }, _showDataBaseInformationList : function() { var self = this, seqVal = []; $("#" + self._containerId + " .userSequence .hdnSequence").each(function() { var tmpPos = $(this).siblings(".hdnPosition").val(); seqVal.push($(this).val() + "[" + tmpPos + "]"); }); self._showDatabaseInfo(seqVal.join(", ")); }, _initReplaceButtonLitener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; $("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() { self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); var seqs = []; $("#" + self._containerId + " .userSequence").each(function() { seqs.push($(this).text()); }); var html = self._appSequence.replace(seqs); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html); self._showDataBaseInformationList(); self._options.callback(); }); }, _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { $("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var container = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); var pos = $(parent).find(".hdnPosition").val(); var seqEl = self._getSeqElBySeq(seq); var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; self._initSequencePopup(seqEl); $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide(); $("#" + self._motifViewDialogId + " .sequence").val(seq); $("#" + self._motifViewDialogId + " .position").val(appropriatePos); $("#" + self._motifViewDialogId + " .extraCopies").val(0); $("#" + self._motifViewDialogId + " .basePairs").val(0); $("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq)); $("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq)); self._initPositionInsert(seq, appropriatePos); $("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); $("#" + self._motifViewDialogId).dialog("open"); $("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); }, _initSequencePopup : function(seqEl) { var self = this; $("#" + self._motifViewDialogId + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; $("#" + self._motifViewDialogId + " .moreInfo").click(function() { self._showPopupWindow(url); }); }, _showPopupWindow : function(url) { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2)); var winTop = parseInt((screen.availHeight/2) - (winHeight/2)); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }, _initPositionInsert : function(seq, pos) { var self = this; var mod = seq.length % 2; $("#" + self._motifViewDialogId + " .position").unbind("keyup"); $("#" + self._motifViewDialogId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(val); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); }, _initMotifViewDialog : function() { var self = this; $("#" + self._motifViewDialogId).dialog({ autoOpen: false, title: self._default.motifViewDialogTitle, width: 520, dialogClass : self._options.motifViewDialogClass, buttons : [ { text: "Replace", click : function() { var seq = $("#" + self._motifViewDialogId).find(".sequence").val(); var pos = $("#" + self._motifViewDialogId).find(".position").val(); var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val()); var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val()); var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html()); var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html()); if (minPos > pos || maxPos < pos) { $dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass); $dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); $dialogError.show(); return; } self._appSequence.hideError(); self._replaceWithSequence(seq, pos, extraCopies, basePairs); $(this).dialog("close"); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, _getMotifMaxTriple : function(workId, fileName, property) { var self = this; var index = new Application.index(1, 8000); var maxTriple; var getTriplesByProperty = function(tripleList) { var maxIndex = -1; var maxValue = -99999; $.each (tripleList, function(tKey, tValue) { var tmpValue = parseFloat(tValue.object); if (Math.max(tmpValue, maxValue) != maxValue) { maxValue = tmpValue; maxIndex = tKey; } }); if (maxIndex != -1) { if (!maxTriple) { maxTriple = tripleList[maxIndex]; } var tmpMaxValue = parseFloat(maxTriple.object); var currentValue = parseFloat(tripleList[maxIndex].object); if (Math.max(tmpMaxValue, currentValue) != tmpMaxValue) { maxTriple = tripleList[maxIndex]; } } if (tripleList && tripleList.length == index.getItemCount()) { LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.increment()); } else { self._motifMaxSequence(workId, fileName, maxTriple.subject, property); } } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.getIndex()); }, _showMotifMaxSequence : function(workId, fileName, propLabel) { var self = this, foundTopFile = false; var getFilesByTag = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { var tmpName = fName.split("_top"); if (fileName.indexOf(tmpName[0]) > -1) { self._getTopFilePropertyList(workId, fileName, wId, fName, propLabel); foundTopFile = true; return false; } }); }); if (!foundTopFile) { var property = self._motifProperty.getPropertyByLabel(propLabel); self._getMotifMaxTriple(workId, fileName, property); } } LinkData.getFilesByTag(null, self._tag.topResult, getFilesByTag); }, _getTopFilePropertyList : function(workId, fileName, topWorkId, topFileName, propLabel) { var self = this; var getProperties = function(propList) { $.each(propList, function(propKey, propValue) { var tmpProperty = self._motifProperty._getLabel(propValue); if (tmpProperty.indexOf(propLabel) > -1) { var property = self._motifProperty.getPropertyByLabel(propLabel); self._showMotifMax(workId, fileName, property, topWorkId, topFileName, propValue); return false; } }); } LinkData.getProperties(topWorkId, topFileName, getProperties); }, _showMotifMax : function(workId, fileName, property, topWorkId, topFileName, topProperty) { var self = this; var index = new Application.index(1, 1000); var getTriplesByProperty = function(tripleList) { self._showMotifMaxByTripleList(workId, fileName, property, tripleList); } LinkData.getTriplesByProperty(topWorkId, topFileName, topProperty, getTriplesByProperty, index.getIndex()); }, _showMotifMaxByTripleList : function(workId, fileName, property, tripleList) { var self = this, i = 0, subject = tripleList[i].object; var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); var showMaxMotif = function(posTripleList) { var found = false; i++; $.each(posTripleList, function(pKey, pValue) { var tmpPos = parseInt(pValue); if (self._options.baseSequenceMinLength < tmpPos && self._options.baseSequence.length >= tmpPos) { found = true; self._motifMaxSequence(workId, fileName, subject, property); return false; } }); if (! found) { subject = tripleList[i].object; LinkData.getObjects(workId, fileName, subject, posProperty, showMaxMotif); } } LinkData.getObjects(workId, fileName, subject, posProperty, showMaxMotif); }, _getDataBaseWebsiteName : function() { var self = this; var fileName = self._options.fileName if (fileName.indexOf(self._options.websiteNameAtted) > -1) { return self._options.websiteNameAtted; } else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) { return self._options.websiteNamePpdb; } else { return "UNKNOWN"; } }, _motifMaxSequence : function(workId, fileName, subject, property) { var self = this; var drawSequence = function(seqHtml) { var sb = []; sb[sb.length] = ""; sb[sb.length] = "
" + self._baseSequence + "
"; sb[sb.length] = seqHtml; $("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join("")); if (seqHtml.length == 0) { $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } self._initMotifSequenceListener(); self._initReplaceButtonLitener(); self._showDataBaseInformationList(); self._showGenePlot(subject, property); $("#" + self._containerId + " ." + self._options.resultAreaClass).show(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show(); $("#" + self._containerId + " ." + self._options.loadingImageContainer).hide(); } self._appSequence.getSequenceHtml(subject, drawSequence); }, _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 1 : 0.5; return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; }, _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; }, _getSeqElBySeq : function(seq) { if (seq && seq.trim().length == 7) { return this._heptamer.getBySequence(seq); } else if (seq && seq.trim().length == 8) { return this._octamer.getBySequence(seq); } }, _showDatabaseInfo : function(seqVal) { var self = this, fileName = self._options.fileName, appName = self._options.appName; var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val(); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var label = self._motifProperty._getDisplayLabel(propLabel); label = (label && label.trim().length != 0) ? label : propLabel; var usedMotif = (seqVal.length != 0) ? seqVal : "-"; var dbInfoHtml = self._getDatabaseInfo(fileName, appName, subject, label, usedMotif); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); self._genePreviewListener(subject); }, _genePreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() { self._showPopupWindow(subject); }); }, _getDatabaseInfo : function(fileName, method, subject, property, motif) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); var sb = []; sb[sb.length] = "
"; sb[sb.length] = "
Database
"; sb[sb.length] = "
" + fileName + "
"; sb[sb.length] = "
"; sb[sb.length] = "
"; sb[sb.length] = "
Application
"; sb[sb.length] = "
" + method + "
"; sb[sb.length] = "
"; sb[sb.length] = "
"; sb[sb.length] = "
Gene Locus
"; sb[sb.length] = "
" + gene + "
"; sb[sb.length] = "
"; sb[sb.length] = "
"; sb[sb.length] = "
Property
"; sb[sb.length] = "
" + property + "
"; sb[sb.length] = "
"; sb[sb.length] = "
"; sb[sb.length] = "
Motif
"; sb[sb.length] = "
" + motif + "
"; sb[sb.length] = "
"; return sb.join(""); }, _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this; var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); var seqLabel = seq + "[" + pos + "]"; self._showDatabaseInfo(seqLabel); self._options.callback(); } }; Application.geneChart = function() { this._init.apply(this, arguments); }; Application.geneChart.prototype = { _containerId : null, _options : null, _workId : null, _fileName : null, _subject : null, _property : null, _highChartContainerId : null, _appProperty : null, _default : { filterNamespace : "http://linkdata.org/", acceptPropLabelPrefix : "label:" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._workId = this._options.workId; this._fileName = this._options.fileName; this._subject = this._options.subject; this._property = this._options.property; var date = new Date(); this._highChartContainerId = "gene_chart_" + date.getTime(); this._initAppProperty(this._options); this._initView(); this._drawHighChart(this._subject, this._property); }, _initAppProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._appProperty = new Application.motifProperty(obj); }, _initView : function() { var self = this; var sb = []; sb[sb.length] = "
"; $("#" + self._containerId).html(sb.join("")); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _drawHighChart : function(subject, highlightProperty) { var self = this; var getDataArray = function(tripleList) { var dataArray = []; var dataObject = {}; var array = []; var duplicateProperty = []; $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var val = parseFloat(tValue.object); if (highlightProperty === property) { val = self._getHighLightColumn(parseFloat(tValue.object)); } array.push(val); duplicateProperty.push(property); } }); dataObject.name = self._getLabel(subject); dataObject.data = array; dataArray.push(dataObject); self._getXCategory(tripleList, dataArray, highlightProperty); } LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray); }, _getXCategory : function(tripleList, dataArray, highlightProperty) { var self = this; var array = []; var duplicateProperty = []; var hLabel = self._getLabelAfterHash(highlightProperty); $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var displayLabel = self._getDisplayLabel(label); var hDisplayLabel = self._getDisplayLabel(hLabel); if (displayLabel === hDisplayLabel) { displayLabel = "" + hDisplayLabel + ""; } array.push(displayLabel); duplicateProperty.push(property); } }); self._drawChart(self._highChartContainerId, dataArray, array); }, _getHighLightColumn : function(val) { var obj = {}; obj.y = val; obj.marker = { lineWidth: 3, lineColor: "#FB3B44", fillColor: "#FB3B44" }; return obj; }, _drawChart : function(containerId, dataArray, xCategory) { var self = this; var chart = new Highcharts.Chart({ chart: { renderTo: containerId, type: 'line', marginRight: 130, marginBottom: 125 }, title: { text: self._fileName }, xAxis: { categories: xCategory, labels : { rotation: 315 } }, tooltip: { formatter: function() { return ''+ this.series.name + '
' + this.x + ' [' + this.y + ']'; } }, legend: { layout: 'vertical', align: 'right', verticalAlign: 'top', x: -10, y: 100, borderWidth: 0 }, series: dataArray }); }, _getLabel : function(value) { var self = this, label; if (value.indexOf("#") > -1) { label = self._getLabelAfterHash(value); } else { label = self._appProperty.getGeneBySubject(value); } if (!label) { label = value; } return label; }, _getPropertyLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); propLabel = this._appProperty.getPropertyNameByLabel(propLabel); } return propLabel; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.motifProperty = function() { this._init.apply(this, arguments); }; Application.motifProperty.prototype = { _options : null, _propMap : null, _nameMap : null, _optionArray : null, _default : { acceptPropLabelPrefix : "label:", subjectATTEDUriPhrase : "http://atted.jp/data/locus/", subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" }, _init : function(options) { this._options = $.extend({}, this._default, options); this._propMap = []; this._nameMap = []; this._initPropMap(this._options); }, _initPropMap : function(opts) { var self = this, workId = opts.workId, fileName = opts.fileName; var method = function(properties) { self._fillPropMap(self, properties); self._initOptionArray(properties); } LinkData.getProperties(workId, fileName, method); }, _fillPropMap : function(self, properties) { $.each(properties, function(key, value) { var label = self._getLabel(value); if (!self._propMap[label]) { self._propMap[label] = value; } }); }, _initOptionArray : function(propertyList) { var self = this, list = new Object(); var workId = self._options.workId, fileName = self._options.fileName; self._optionArray = []; $.each(propertyList, function(key, value) { var propLabel = self._getLabel(value); if (!self._ignore(propLabel)) { var obj = {}; obj.key = propLabel; obj.value = self._getDisplayLabel(propLabel); self._optionArray.push(obj); } }); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, getOptionArray : function() { return this._optionArray; }, getPropertyByLabel : function(label) { return this._propMap[label]; }, getGeneBySubject : function(subject) { var self = this, htmlExt = ".html", geneLabel; if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, ""); } else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, ""); } if (geneLabel && geneLabel.indexOf(htmlExt) > -1) { geneLabel = geneLabel.replace(htmlExt, ""); } return geneLabel; } }; Application.sequence = function() { this._init.apply(this, arguments); }; Application.sequence.prototype = { CHAR_SEQ_EMPTY : "-", _options : null, _workId : null, _fileName : null, _seqProperty : null, _posProperty : null, _baseSequence : null, _sequenceList : null, _positionList : null, _containerId : null, _errorContainerClass : null, _outOfRangeArray : null, _default : { msgInvalidSequence: "invalid sequence.", msgOutOfRangeSequence: "out of range sequence : {0}", }, _init : function(options) { this._options = options; this._workId = this._options.workId; this._fileName = this._options.fileName; this._seqProperty = this._options.motifSequenceProperty; this._posProperty = this._options.motifPositionProperty; this._baseSequence = this._options.baseSequence; this._containerId = this._options.containerId; this._errorContainerClass = this._options.errorMessageClass; }, _getCustomSequenceHtml : function(baseSequence, sequence, position) { var seqLen = sequence.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(position); var baseSeqLen = baseSequence.length; var suffixLen = baseSeqLen - tHold - pos; var sb = []; if (pos > this._options.baseSequenceMinLength && suffixLen > 0) { for (var i = 0; i < suffixLen; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push("" + sequence + ""); sb.push(""); sb.push(""); } else { //_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence)); this._outOfRangeArray.push(sequence + "[" + pos + "]"); this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.join(", "))); } return sb.join(""); }, _isValidSequenceList : function(seqs) { var count = seqs.length; var maxlength = 0; for (var i = 0; i < count; i++) { if (seqs[i].length > maxlength) { maxlength = seqs[i].length; } } var result = true; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i)); } if (! this._isValidChars(chars.join(""))) { result = false; break; } } return result; }, _isValidChars : function(charString) { var charLen = charString.length; var result = true; var first = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) == this.CHAR_SEQ_EMPTY) { continue; } if (! first) { first = charString.charAt(i); } var current = charString.charAt(i); if (current && first != current) { result = false; break; } } return result; }, _getReplacedCustomSequence : function(seqs) { var mergeSequence = this._getmergeCharSequence(seqs); var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var bChar = this._baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY) { // replaced sb.push(mChar); } else { sb.push(bChar); } } return sb.join(""); }, _getmergeCharSequence : function(seqs) { var count = seqs.length; var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i) ? seqs[j].charAt(i) : this.CHAR_SEQ_EMPTY); } sb.push(this._getMergeChar(chars.join(""))); } return sb.join(""); }, _getMergeChar : function(charString) { var charLen = charString.length; var result = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) { result = charString.charAt(i); break; } } if (!result) { result = this.CHAR_SEQ_EMPTY; } return result; }, _wrappedReplacedSequenceHtml : function(replaceSequence, seqs) { var mergeSequence = this._getmergeCharSequence(seqs); var length = this._baseSequence.length; var sb = []; for (var i = 0; i < length; i++) { var bChar = this._baseSequence.charAt(i); var rChar = replaceSequence.charAt(i); var mChar = mergeSequence.charAt(i); var seqChar = (bChar !== rChar) ? "" + rChar + "" : rChar; if (mChar !== this.CHAR_SEQ_EMPTY) { sb.push("" + seqChar + ""); } else { sb.push(seqChar); } } return sb.join(""); }, _showError : function(message) { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass); $errorMessageContainer.html(message); $errorMessageContainer.show(); }, getSequenceHtml : function(subject, drawSequence) { var self = this; self._outOfRangeArray = []; var sb = [], baseSequence = self._baseSequence; var getTriplesBySequenceProperty = function(sequenceList) { self._getTriplesBySequenceProperty(subject, drawSequence, sequenceList); } LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty, getTriplesBySequenceProperty); }, _getTriplesBySequenceProperty : function(subject, drawSequence, sequenceList) { var self = this; var getTriplesByPositionProperty = function(positionList) { self._drawSequenceList(drawSequence, sequenceList, positionList); } LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty, getTriplesByPositionProperty); }, _drawSequenceList : function(drawSequence, sequenceList, positionList) { var self = this, sb = []; if (!sequenceList || sequenceList.length == 0) { return; } for (var i = 0; i < sequenceList.length; i++) { var customSeqString = self._getCustomSequenceHtml(self._baseSequence, sequenceList[i], positionList[i]); if (customSeqString.length > 0) { sb.push("
" + customSeqString + "
"); } } drawSequence(sb.join("\n")); }, replace : function(seqs) { var isValid = this._isValidSequenceList(seqs); if (isValid) { if (seqs.length > 0) { var replaceSeq = this._getReplacedCustomSequence(seqs); var replaceSeqHtml = this._wrappedReplacedSequenceHtml(replaceSeq, seqs); return replaceSeqHtml; } } else { this._showError(this._default.msgInvalidSequence); } }, replaceWith : function(seq, pos, extraCopies, basePairs) { var main = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(pos); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - tHold - pos; for (var j = 0; j < extraCopies + 1; j++) { var array = []; for (var i = 0; i < len; i++) { array.push(this.CHAR_SEQ_EMPTY); } array.push(seq); main.push(array.join("")); len = len - seqLen - basePairs; if (len < 0) { break; } } return this.replace(main); }, hideError : function() { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide(); } }; Application.heptamer = function() { this._init.apply(this, arguments); }; Application.heptamer.prototype = { _heptamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { heptamerTag : "heptamer", filterSequencePropertyPhrase : "motif_sequence", filterMaxCEGPropertyPhrase : "maxCEG", filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)" }, _init : function() { this._heptamerMap = []; this._initHeptamerList(); }, _initHeptamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initHeptamer(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._default.heptamerTag, getFilesByTag); }, _initHeptamer : function(workId, fileName) { var self = this; var getPropertyList = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); } LinkData.getProperties(workId, fileName, getPropertyList); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillHeptamerMap(workId, fileName, sequenceTripleList); } LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillHeptamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { for (var i = 0; i < sequenceTripleList.length; i++) { var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[i]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._heptamerMap[seqTriple.object] = seqEl; } } LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._heptamerMap[sequence]; } }; Application.octamer = function() { this._init.apply(this, arguments); } Application.octamer.prototype = { _octamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { octamerTag : "octamer", filterSequencePropertyPhrase : "sequence", filterAppropriatePosition : "Appropriate%20position" }, _init : function() { this._octamerMap = []; this._initOctamerList(); }, _initOctamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initOctamer(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._default.octamerTag, getFilesByTag); }, _initOctamer : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); } LinkData.getProperties(workId, fileName, getProperties); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillOctamerMap(workId, fileName, sequenceTripleList); } LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillOctamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { for (var i = 0; i < sequenceTripleList.length; i++) { var j = Math.floor(i / 2); var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[j]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._octamerMap[seqTriple.object] = seqEl; } } LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._octamerMap[sequence]; } }; Application.seqElement = function() { this._init.apply(this, arguments); }; Application.seqElement.prototype = { _externalUrl : null, _sequence : null, _appropriatePos : null, _init : function() {}, getExternalUrl : function() { return this._externalUrl; }, setExternalUrl : function(externalUrl) { this._externalUrl = externalUrl; }, getSequence : function() { return this._sequence; }, setSequence : function(sequence) { this._sequence = sequence; }, getAppropriatePos : function() { return this._appropriatePos; }, setAppropriatePos : function(appropriatePos) { this._appropriatePos = appropriatePos; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 100; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; } }; Application.index = function() { this._init.apply(this, arguments); } Application.index.prototype = { _start : null, _end : null, _init : function(start, end) { this._start = start; this._end = end; }, getIndex : function() { return {start : this._start, end : this._end}; }, getItemCount : function() { return (this._end - this._start + 1); }, increment : function() { var itemCount = this.getItemCount(); this._start = this._start + itemCount; this._end = this._end + itemCount; return {start : this._start, end : this._end}; }, getStartIndex : function() { return this._start; }, getEndIndex : function() { return this._end; } }; $(document).ready(function() { var fillDatabase = function(resultList) { $(".motifMaxDatabase").append(""); $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { $(".motifMaxDatabase").append(""); }); }); $(".motifMaxDatabase").change(function() { var dbKey = $("option:selected", $(this)).val(); if (dbKey == -1) { $("#container").html(""); return; } var array = dbKey.split("|"); var containerId = "container"; var options = { workId : array[0], fileName : array[1], baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" }; new Application.motifMax(containerId, options); }); } LinkData.getFilesByTag(null, "database", fillDatabase); });