Publish your application｜Mash up the Linked Open Data

HighChart2 = function(containerId, options) {
	new Application.highChart(containerId, options);
};

if (Application === "undefined" || !Application) {
	var Application = {};
}

Application.highChart = function() {
	this._init.apply(this, arguments);
};

Application.highChart.prototype = {
	
	_containerId : null,
	_options : null,
	_workId : null,
	_fileName : null,
	_highChartContainerId : null,
	_appProperty : null,
	
	_default : {
		filterNamespace : "http://linkdata.org/",
		subjectUriPhrase : "http://atted.jp/data/locus/",
		subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=",
		selectSubjectClass : "selectSubject",
		drawArea : "drawArea",
		loadingImageContainer : "loadingImageContainer",
		acceptPropLabelPrefix : "label:",
		loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif"
	},
	
	_init : function(containerId, options) {
		this._containerId = containerId;
		this._options = $.extend({}, this._default, options);
		this._workId = this._options.workId;
		this._fileName = this._options.fileName;
		var date = new Date();
		this._highChartContainerId = "high_chart_" + date.getTime();
		this._initAppProperty(this._options);
		this._initView();
		//this._initSelect();
	},
	
	_initAppProperty : function(opts) {
		var obj = {
			workId : opts.workId,
			fileName : opts.fileName
		};
		this._appProperty = new Application.motifProperty(obj);
	},
	
	_initView : function() {
		var self = this;
		var initView = function(subjectList) {
			var sb = [];
			sb[sb.length] = "<div class='row'>";
			sb[sb.length] = "<div class='label left'>Select Subject</div>";
			sb[sb.length] = "<div class='left'>";
			sb[sb.length] = "<select class='" + self._default.selectSubjectClass + "'>";
			sb[sb.length] = "<option value='" + -1 + "'>-- Select Subject --</option>";
			$.each(subjectList, function(subKey, subValue) {
				var label = self._getLabel(subValue);
				sb[sb.length] = "<option value='" + subValue + "'>" + label + "</option>";
			});
			sb[sb.length] = "</select>";
			sb[sb.length] = "</div>";
			sb[sb.length] = "</div>";
			sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>";
			sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>";
			sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>";
			sb[sb.length] = "</div>";
			//$("#" + self._containerId).append(sb.join(""));
			$("#" + self._containerId).html(sb.join(""));
			self._initSelect();
		}
		LinkData.getSubjects(self._workId, self._fileName, initView);
	},
	
	_initSelect : function() {
		var self = this;
		var timer = new Application.timer();
		var initSelect = function() {
			$select = $("#" + self._containerId + " ." + self._default.selectSubjectClass);
			if ($select.length != 0) {
				$select.change(function() {
					$("#" + self._containerId + " ." + self._options.loadingImageContainer).show();
					var subject = $("option:selected", this).val();
					self._drawHighChart(subject);
					//var dataArray = self._getDataArray(self._workId, self._fileName, subject);
					//var xCategory = self._getXCategory(self._workId, self._fileName, subject);
					//self._drawChart(self._highChartContainerId, dataArray, xCategory);
				});
			} else {
				timer.call(initSelect);
			}
		}
		initSelect();
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_drawHighChart : function(subject) {
		var self = this;
		var getDataArray = function(tripleList) {
			var dataArray = [];
			var dataObject = {};
			var array = [];
			var duplicateProperty = [];
			$.each (tripleList, function(tKey, tValue) {
				var property = tValue.property;
				if (property.indexOf(self._options.filterNamespace) == -1) {
					return;
				}
				if ($.inArray(property, duplicateProperty) > -1) {
					return;
				}
				var label = self._getLabelAfterHash(property);
				if (!self._ignore(label)) {
					array.push(parseFloat(tValue.object));
					duplicateProperty.push(property);
				}
			});
			dataObject.name = self._getLabel(subject);
			dataObject.data = array;
			dataArray.push(dataObject);
			self._getXCategory(tripleList, dataArray);
		}
		LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray);
	},
	
	_getXCategory : function(tripleList, dataArray) {
		var self = this;
		var array = [];
		var duplicateProperty = [];
		$.each (tripleList, function(tKey, tValue) {
			var property = tValue.property;
			if (property.indexOf(self._options.filterNamespace) == -1) {
				return;
			}
			if ($.inArray(property, duplicateProperty) > -1) {
				return;
			}
			var label = self._getLabelAfterHash(property);
			if (!self._ignore(label)) {
				array.push(self._getDisplayLabel(label));
				duplicateProperty.push(property);
			}
		});
		self._drawChart(self._highChartContainerId, dataArray, array);
		$("#" + self._containerId + " ." + self._options.loadingImageContainer).hide();
	},
	
	_drawChart : function(containerId, dataArray, xCategory) {
		var self = this;
		var chart = new Highcharts.Chart({
			chart: {
				renderTo: containerId,
				type: 'line',
				marginRight: 130,
				marginBottom: 125
			},
			title: {
				text: self._fileName
			},
			xAxis: {
				categories: xCategory,
				labels : {
					rotation: 315
				}
			},
			tooltip: {
				formatter: function() {
					return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']';
				}
			},
			legend: {
				layout: 'vertical',
				align: 'right',
				verticalAlign: 'top',
				x: -10,
				y: 100,
				borderWidth: 0
			},
			series: dataArray
 		});
	},
	
	/*
	_getLabel : function(value) {
		var self = this;
		if (value.indexOf(self._default.subjectUriPhrase) > -1) {
			var propLabel = value;
			var arr = value.split(self._default.subjectUriPhrase);
			if (arr.length > 1) {
				propLabel = decodeURIComponent(arr[1]);
			}
			return propLabel;
		} else if (value.indexOf(self._default.subjectPPDBUriPhrase) > -1) {
			var propLabel = value;
			var arr = value.split(self._default.subjectPPDBUriPhrase);
			if (arr.length > 1) {
				propLabel = decodeURIComponent(arr[1]);
			}
			return propLabel;
		} else if (value.indexOf("#") > -1) {
			return self._getLabelAfterHash(value);
		}
		return value;
	},
*/
	_getLabel : function(value) {
		var self = this, label;
		if (value.indexOf("#") > -1) {
			label = self._getLabelAfterHash(value);
		} else {
			label = self._appProperty.getGeneBySubject(value);
		}
		if (!label) {
			label = value;
		}
		return label;
	},
	
	_getPropertyLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
			propLabel = this._appProperty.getPropertyNameByLabel(propLabel);
		}
		return propLabel;
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
	
};

Application.motifProperty = function() {
	this._init.apply(this, arguments);
};

Application.motifProperty.prototype = {

_options : null,
	_propMap : null,
	_nameMap : null,
	_optionArray : null,
	
	_default : {
		acceptPropLabelPrefix : "label:",
		subjectATTEDUriPhrase : "http://atted.jp/data/locus/",
		subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene="
	},
	
	_init : function(options) {
		this._options = $.extend({}, this._default, options);
		this._propMap = [];
		this._nameMap = [];
		this._initPropMap(this._options);
	},
	
	_initPropMap : function(opts) {
		var self = this, workId = opts.workId, fileName = opts.fileName;
		var method = function(properties) {
			self._fillPropMap(self, properties);
			self._initOptionArray(properties);
		}
		LinkData.getProperties(workId, fileName, method);
	},
	
	_fillPropMap : function(self, properties) {
		$.each(properties, function(key, value) {
			var label = self._getLabel(value);
			if (!self._propMap[label]) {
				self._propMap[label] = value;
			}
		});
	},
	
	_initOptionArray : function(propertyList) {
		var self = this, list = new Object();
		var workId = self._options.workId, fileName = self._options.fileName;
		self._optionArray = [];
		$.each(propertyList, function(key, value) {
			var propLabel = self._getLabel(value);
			if (!self._ignore(propLabel)) {
				var obj = {};
				obj.key = propLabel;
				obj.value = self._getDisplayLabel(propLabel);
				self._optionArray.push(obj);
			}
		});
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_getLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},

getOptionArray : function() {
		return this._optionArray;
	},
	
	getPropertyByLabel : function(label) {
		return this._propMap[label];
	},
	
	getGeneBySubject : function(subject) {
		var self = this, htmlExt = ".html", geneLabel;
		if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, "");
		} else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, "");
		}
		if (geneLabel && geneLabel.indexOf(htmlExt) > -1) {
			geneLabel = geneLabel.replace(htmlExt, "");
		}
		return geneLabel;
	}
	
};

Application.timer = function() {
	this._init.apply(this, arguments);
};

Application.timer.prototype = {
	
	_delay : null,
	_retry : null,
	_maxRetry : null,
	
	_init : function() {
		this._delay = 1000;
		this._retry = 0;
		this._maxRetry = 100;
	},
	
	call : function(func) {
		if (this._retry < this._maxRetry) {
			setTimeout(func, this._delay);
		}
		this._retry++;
	}
};

$(document).ready(function(){
	var fillDatabase = function(resultList) {
		$(".highChartDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>");
		$.each(resultList, function(workId, fileList) {
			$.each(fileList, function(fileKey, fileName) {
				$(".highChartDatabase").append("<option value='" + workId + "|" + fileName + "'>" + fileName + "</option>");
			});
		});
		$(".highChartDatabase").change(function() {
			var dbKey = $("option:selected", $(this)).val();
			if (dbKey == -1) {
				$("#container").html("");
				return;
			}
			var array = dbKey.split("|");
			var containerId = "container";
			var options = {
				workId : array[0],
				fileName : array[1],
				baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC"
			};
			new Application.highChart(containerId, options);
		});
	}
	LinkData.getFilesByTag(null, "database", fillDatabase);
});

body {
    font-family: sans-serif;
    font-size: 14px;
}
a {
    color: #3B5998;
    font-weight: bold;
    text-decoration: none;
}

.hidden {
	display:none;
}

.left {
    float: left;
}

.label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    min-width: 125px;
}

.row {
    padding: 5px 0;
}

.row:after {
    content: "";
    clear: left;
    display: block;
}

.row input[type="text"] {
    width: 200px;
}

.btn {
  display: inline-block;
  *display: inline;
  /* IE7 inline-block hack */

*zoom: 1;
  padding: 4px 10px 4px;
  margin-bottom: 0;
  font-size: 13px;
  line-height: 18px;
  color: #333333;
  text-align: center;
  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);
  vertical-align: middle;
  background-color: #f5f5f5;
  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));
  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: linear-gradient(top, #ffffff, #e6e6e6);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);
  border-color: #e6e6e6 #e6e6e6 #bfbfbf;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
  border: 1px solid #cccccc;
  border-bottom-color: #b3b3b3;
  -webkit-border-radius: 4px;
  -moz-border-radius: 4px;
  border-radius: 4px;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  cursor: pointer;
  *margin-left: .3em;
}

.btn:hover,
.btn:active,
.btn.active,
.btn.disabled,
.btn[disabled] {
  background-color: #e6e6e6;
}

.btn:hover {
  color: #333333;
  text-decoration: none;
  background-color: #e6e6e6;
  background-position: 0 -15px;
  -webkit-transition: background-position 0.1s linear;
  -moz-transition: background-position 0.1s linear;
  -ms-transition: background-position 0.1s linear;
  -o-transition: background-position 0.1s linear;
  transition: background-position 0.1s linear;
}

.btn-blue,
.btn-blue:hover,
.btn-yellow,
.btn-yellow:hover,
.btn-red,
.btn-red:hover,
.btn-green,
.btn-green:hover,
.btn-lightblue,
.btn-lightblue:hover,
.btn-black,
.btn-black:hover {
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
  color: #ffffff;
}

.btn-blue {
  background-color: #0074cc;
  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);
  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));
  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);
  background-image: -o-linear-gradient(top, #0088cc, #0055cc);
  background-image: linear-gradient(top, #0088cc, #0055cc);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);
  border-color: #0055cc #0055cc #003580;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}

.btn-blue:hover,
.btn-blue:active,
.btn-blue.active,
.btn-blue.disabled,
.btn-blue[disabled] {
  background-color: #0055cc;
}

.btn-green {
  background-color: #5bb75b;
  background-image: -moz-linear-gradient(top, #62c462, #51a351);
  background-image: -ms-linear-gradient(top, #62c462, #51a351);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));
  background-image: -webkit-linear-gradient(top, #62c462, #51a351);
  background-image: -o-linear-gradient(top, #62c462, #51a351);
  background-image: linear-gradient(top, #62c462, #51a351);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);
  border-color: #51a351 #51a351 #387038;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-green:hover,
.btn-green:active,
.btn-green.active,
.btn-green.disabled,
.btn-green[disabled] {
  background-color: #51a351;
}
.btn-green:active,
.btn-green.active {
  background-color: #408140 ¥9;
}
.btn-lightblue {
  background-color: #49afcd;
  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));
  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: linear-gradient(top, #5bc0de, #2f96b4);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);
  border-color: #2f96b4 #2f96b4 #1f6377;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-lightblue:hover,
.btn-lightblue:active,
.btn-lightblue.active,
.btn-lightblue.disabled,
.btn-lightblue[disabled] {
  background-color: #2f96b4;
}

Select Input Data

LinkData Work	Table Data
Circadian Coexpression (DIURNAL + ATTED-II promoter motif) Full	DiurnalHours_ATTED_COL_LDHH DiurnalHours_ATTED_COL_SD DiurnalHours_ATTED_DD_DDHC DiurnalHours_ATTED_LDHC DiurnalHours_ATTED_LDHH_SM DiurnalHours_ATTED_LDHH_ST DiurnalHours_ATTED_LER_SD DiurnalHours_ATTED_LIGHT5_HIF138_13 DiurnalHours_ATTED_LIGHT5_HIF138_8 DiurnalHours_ATTED_LIGHT5_znknOX DiurnalHours_ATTED_LL12_LDHH DiurnalHours_ATTED_LL23_LDHH DiurnalHours_ATTED_LLHC DiurnalHours_ATTED_LL_LDHC DiurnalHours_ATTED_LL_LLHC DiurnalHours_ATTED_lhyox_SD DiurnalHours_ATTED_longday DiurnalHours_ATTED_lux_2_LDHH DiurnalHours_ATTED_phyB9_SD DiurnalHours_ATTED_shortday
Circadian Genomic (DIURNAL + PPDB promoter motif) Full	DiurnalHours_PPDB_COL_LDHH DiurnalHours_PPDB_COL_SD DiurnalHours_PPDB_DD_DDHC DiurnalHours_PPDB_LDHC DiurnalHours_PPDB_LDHH_SM DiurnalHours_PPDB_LDHH_ST DiurnalHours_PPDB_LER_SD DiurnalHours_PPDB_LIGHT5_HIF138_13 DiurnalHours_PPDB_LIGHT5_HIF138_8 DiurnalHours_PPDB_LIGHT5_znknOX DiurnalHours_PPDB_LL12_LDHH DiurnalHours_PPDB_LL23_LDHH DiurnalHours_PPDB_LLHC DiurnalHours_PPDB_LL_LDHC DiurnalHours_PPDB_LL_LLHC DiurnalHours_PPDB_lhyox_SD DiurnalHours_PPDB_longday DiurnalHours_PPDB_lux_2_LDHH DiurnalHours_PPDB_phyB9_SD DiurnalHours_PPDB_shortday
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full	AtGenExpress_ATTED_Flowering AtGenExpress_ATTED_Fruit_Seeds AtGenExpress_ATTED_Leaf AtGenExpress_ATTED_Root AtGenExpress_ATTED_Seedling AtGenExpress_ATTED_Stem AtGenExpress_ATTED_Whole_Plant Heptamer_elements PPDB_position
GenoCon2 Challenge A - Sequence Function Plugins	Application_Plugins_for_Synthetic_Promoter_Design
Developmental Genomic (AtGenExpress + PPDB promoter motif) Full	AtGenExpress_PPDB_Flowering AtGenExpress_PPDB_Fruit_Seeds AtGenExpress_PPDB_Leaf AtGenExpress_PPDB_Root AtGenExpress_PPDB_Seedling AtGenExpress_PPDB_Stem AtGenExpress_PPDB_Whole_Plant Octamer_elements

Add LinkData work(LinkData)

<p>
<i>Below is a description of the plug-in function to the GenoCon CAD Application. For the GenoCon2 Special Programming Challenge A, you should replace this with a report of your own program.</i><br>
</p>

<h1 align="CENTER">Title: HighChart: a plug-in function to the DNA CAD program for Challenge A</h1>

<p align="CENTER">
<b>Name: RIKEN GenoCon</b></p>
<p align="CENTER"><b>Affiliation: RIKEN The Institute of Physical and Chemical Research</b>
</p>
<p align="CENTER">
Date: 2012-10-17</p>

<h2>Abstract</h2>
<p>
<a href="http://app.linkdata.org/app/app1s94i">The GenoConPromoterCAD program</a> provides several plugin functions for promoter designs.
<a href="http://app.linkdata.org/app/app1s98i">HighChart function</a> provides graph visualization of expression data under experimental conditions (<a href="http://arabidopsis.org/servlets/TairObject?type=expression_set&id=1006710873">AtGenExpress</a>) and time evolution of expression under circadian conditions (<a href="http://diurnal.mocklerlab.org/diurnal_data_finders/new">DIURNAL</a>).
Programmer participants can fork and add to these functions for the GenoCon2 Special Programming Challenge A.
</p>

Click the Browse button or drag and drop to choose files to upload

The Maximum upload size is 1MB.(bmp,gif,jpeg,jpg,png)

Edit Application

Please enter information for the application to be registered.

*Required field

Account Name

Application Name*: Remove; Add name for another language

Collaborators

Image: Change image

You can upload jpg, gif, png file formats

Website: x

Add website

Tag

License

API version

Initial Cost: ￥

Annual Cost: ￥

Description: <b> This is a plug-in function to <a href="http://app.linkdata.org/app/app1s94i" target="_blank">the DNA CAD program for Challenge A</a>.</b> <br> <br> <br> <i> To make your own function, copy this sample function using the “Fork this app as your new one” button at the bottom. You can modify and make new functions as plugins to the CAD Application. </i> <br> <br>For more information see: <a href="http://genocon.org/assignment-2012/assignment-a/manuals-a/" target="_blank">http://genocon.org/assignment-2012/assignment-a/manuals-a/</a> <br> <br> <br> <p><i>For guidelines for submitting your own program, please see the "ReadMe" tab special programing Challenge A sample report.</i> </p> <br> <br> Remove; Add description for another language

Security Level: public limited private

: finish Editing

Select Input Data

Edit Application

Please enter information for the application to be registered.

History