Publish your application｜Mash up the Linked Open Data

LocusSelect = function(containerId, options) {
	new Application.highChart(containerId, options);
};

if (Application === "undefined" || !Application) {
	var Application = {};
}

Application.highChart = function() {
	this._init.apply(this, arguments);
};

Application.highChart.prototype = {
	
	_containerId : null,
	_options : null,
	_workId : null,
	_fileName : null,
	_highChartContainerId : null,
	_appProperty : null,
	
	_default : {
		appName : "LocusSelect",
		filterNamespace : "http://linkdata.org/",
		subjectUriPhrase : "http://atted.jp/data/locus/",
		subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=",
		selectSubjectClass : "selectSubject",
		drawArea : "drawArea",
		loadingImageContainer : "loadingImageContainer",
		acceptPropLabelPrefix : "label:",
		loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif",
		databaseInfoClass : "databaseInfo",
		dbInfoLinkClass : "dbInfoLink",
		geneInfoLinkClass : "geneInfoLink",
		geneInfoAttedLinkClass : "geneInfoAttedLink",
		geneInfoPpdbLinkClass : "geneInfoPpdbLink",
		geneInfoEfpLinkClass : "geneInfoEfpLink",
		geneInfoHannaDbLinkClass : "geneInfoHannaDbLink",
		serverUrl : "http://linkdata.org/",
		yAxisLabel : "Gene Expression Level"
	},
	
	_tooltipName : {
		selectProperty : "selectproperty",
		atted2 : "atted-ii",
		hanaDb : "hanadb",
		efp : "efp",
		ppdb : "ppdb",
		replace : "replace",
		manuallyInputMotif : "userinputmotif",
		locusSelect : "locusSelect"
	},
	
	_init : function(containerId, options) {
		this._containerId = containerId;
		this._options = $.extend({}, this._default, options);
		this._workId = this._options.workId;
		this._fileName = this._options.fileName;
		var date = new Date();
		this._highChartContainerId = "high_chart_" + date.getTime();
		this._initToolTip();
		this._initAppProperty(this._options);
		this._initView();
	},
	
	_initToolTip : function() {
		var self = this;
		self._tooltip = (self._options.tooltip) ? self._options.tooltip : new Application.tooltip();
	},
	
	_initAppProperty : function(opts) {
		var obj = {
			workId : opts.workId,
			fileName : opts.fileName
		};
		this._appProperty = new Application.motifProperty(obj);
	},
	
	_initView : function() {
		var self = this;
		var initView = function(subjectList) {
			var sb = [];
			sb[sb.length] = "<div class='row'>";
			sb[sb.length] = "<div class='label left'>Select Locus</div>";
			sb[sb.length] = "<div class='left'>";
			sb[sb.length] = "<select class='" + self._default.selectSubjectClass + "'>";
			sb[sb.length] = "<option value='" + -1 + "'>-- Select Locus --</option>";
			$.each(subjectList, function(subKey, subValue) {
				var label = self._getLabel(subValue);
				sb[sb.length] = "<option value='" + subValue + "'>" + label + "</option>";
			});
			sb[sb.length] = "</select>";
			sb[sb.length] = "</div>";
			sb[sb.length] = "</div>";
			sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>";
			sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>";
			sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>";
			sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>";
			sb[sb.length] = "</div>";
			$("#" + self._containerId).html(sb.join(""));
			self._initSelect();
		}
		LinkData.getSubjects(self._workId, self._fileName, initView);
	},
	
	_initSelect : function() {
		var self = this;
		var timer = new Application.timer();
		var initSelect = function() {
			$select = $("#" + self._containerId + " ." + self._default.selectSubjectClass);
			if ($select.length != 0) {
				$select.change(function() {
					$("#" + self._containerId + " ." + self._options.loadingImageContainer).show();
					var subject = $("option:selected", this).val();
					self._drawHighChart(subject);
				});
			} else {
				timer.call(initSelect);
			}
		}
		initSelect();
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_drawHighChart : function(subject) {
		var self = this;
		var getDataArray = function(tripleList) {
			var dataArray = [];
			var dataObject = {};
			var array = [];
			var duplicateProperty = [];
			$.each (tripleList, function(tKey, tValue) {
				var property = tValue.property;
				if (property.indexOf(self._options.filterNamespace) == -1) {
					return;
				}
				if ($.inArray(property, duplicateProperty) > -1) {
					return;
				}
				var label = self._getLabelAfterHash(property);
				if (!self._ignore(label)) {
					array.push(parseFloat(tValue.object));
					duplicateProperty.push(property);
				}
			});
			dataObject.name = self._getLabel(subject);
			dataObject.data = array;
			dataArray.push(dataObject);
			self._getXCategory(tripleList, dataArray);
			self._showDatabaseInfo(subject);
		}
		LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray);
	},
	
	_getXCategory : function(tripleList, dataArray) {
		var self = this;
		var array = [];
		var duplicateProperty = [];
		$.each (tripleList, function(tKey, tValue) {
			var property = tValue.property;
			if (property.indexOf(self._options.filterNamespace) == -1) {
				return;
			}
			if ($.inArray(property, duplicateProperty) > -1) {
				return;
			}
			var label = self._getLabelAfterHash(property);
			if (!self._ignore(label)) {
				array.push(self._getDisplayLabel(label));
				duplicateProperty.push(property);
			}
		});
		self._drawChart(self._highChartContainerId, dataArray, array);
		$("#" + self._containerId + " ." + self._options.loadingImageContainer).hide();
	},
	
	_drawChart : function(containerId, dataArray, xCategory) {
		var self = this;
		var chart = new Highcharts.Chart({
			chart: {
				renderTo: containerId,
				type: 'line',
				marginRight: 130,
				marginBottom: 125
			},
			title: {
				text: self._fileName
			},
			xAxis: {
				categories: xCategory,
				labels : {
					rotation: 315
				}
			},
			yAxis: {
				title: {
        			text: self._default.yAxisLabel
    			}
			},
			tooltip: {
				formatter: function() {
					return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']';
				}
			},
			legend: {
				layout: 'vertical',
				align: 'right',
				verticalAlign: 'top',
				x: -10,
				y: 100,
				borderWidth: 0
			},
			series: dataArray
 		});
	},
	
	_showDatabaseInfo : function(subject) {
		var self = this, fileName = self._options.fileName, appName = self._options.appName;
		var gene = self._getLabel(subject);
		var dbInfoHtml = self._getDatabaseInfo(fileName, appName, gene);
		$("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml);
		$("#" + self._containerId + " ." + self._options.databaseInfoClass).show();
		self._previewListener(subject, gene);
	},
	
	_previewListener : function(subject, gene) {
		var self = this;
		self._dbPreviewListener();
		self._genePreviewListener(subject);
		self._attedPreviewListener(subject);
		self._ppdbPreviewListener(gene);
		self._efpPreviewListener(gene);
		self._hannaDbPreviewListener(gene);
	},
	
	_dbPreviewListener : function() {
		var self = this;
		var workId = self._options.workId, fileName = self._options.fileName;
		var url = self._options.serverUrl + "work/" + workId + "/" + fileName + ".html#work_information";
		$("#" + self._containerId + " ." + self._options.dbInfoLinkClass).click(function() {
			self._showPopupWindow(url);
		});
	},
	
	_genePreviewListener : function(subject) {
		var self = this;
		$("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() {
			self._showPopupWindow(subject);
		});
	},
	
	_attedPreviewListener : function(subject) {
		var self = this;
		$("#" + self._containerId + " ." + self._options.geneInfoAttedLinkClass).click(function() {
			self._showPopupWindow(subject);
		});
	},
	
	_ppdbPreviewListener : function(gene) {
		var self = this;
		var url = "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene.toString().toUpperCase();
		$("#" + self._containerId + " ." + self._options.geneInfoPpdbLinkClass).click(function() {
			self._showPopupWindow(url);
		});
	},
	
	_efpPreviewListener : function(gene) {
		var self = this;
		var url = "http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi?dataSource=Developmental_Map&modeInput=Absolute&primaryGene=" + gene;
		$("#" + self._containerId + " ." + self._options.geneInfoEfpLinkClass).click(function() {
			self._showPopupWindow(url);
		});
	},
	
	_hannaDbPreviewListener : function(gene) {
		var self = this;
		var url = "http://evolver.psc.riken.jp/seiken/GENE/" + gene.toUpperCase() + ".html";
		$("#" + self._containerId + " ." + self._options.geneInfoHannaDbLinkClass).click(function() {
			self._showPopupWindow(url);
		});
	},
	
	_getDatabaseInfo : function(fileName, method, gene) {
		var self = this;
		var sb = [];
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Database</div>";
		sb[sb.length] = "<div class='left'>";
		sb[sb.length] = "<span title='" + self._tooltip.getByKey(fileName) + "'>" + fileName + "</span>";
		sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.dbInfoLinkClass + "'>LinkData</a>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Tool</div>";
		sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(self._tooltipName.locusSelect) + "'>" + method + "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Gene Locus</div>";
		sb[sb.length] = "<div class='left'>";
		sb[sb.length] = "<span>" + gene + "</span>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Motif Analysis Links</div>";
		sb[sb.length] = "<div class='left'>";
		sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.atted2) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoAttedLinkClass + "'>ATTED-II</a>";
		sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.ppdb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoPpdbLinkClass + "'>PPDB</a>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "<div class='row'>";
		sb[sb.length] = "<div class='label left'>Gene Expression Visualization Links</div>";
		sb[sb.length] = "<div class='left'>";
		sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.efp) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoEfpLinkClass + "'>eFP</a>";
		sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.hanaDb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoHannaDbLinkClass + "'>HanaDB</a>";
		sb[sb.length] = "</div>";
		sb[sb.length] = "</div>";
		
		return sb.join("");
	},
	
	_showPopupWindow : function(url) {
		var winWidth = 800;
		var winHeight = 800;
		var winLeft = parseInt((screen.availWidth/2) - (winWidth/2));
		var winTop = parseInt((screen.availHeight/2) - (winHeight/2));
		var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1";
		window.open(url, "Motif", winStyle);
	},
	
	_getLabel : function(value) {
		var self = this, label;
		if (value.indexOf("#") > -1) {
			label = self._getLabelAfterHash(value);
		} else {
			label = self._appProperty.getGeneBySubject(value);
		}
		if (!label) {
			label = value;
		}
		return label;
	},
	
	_getPropertyLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
			propLabel = this._appProperty.getPropertyNameByLabel(propLabel);
		}
		return propLabel;
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
	
};

Application.motifProperty = function() {
	this._init.apply(this, arguments);
};

Application.motifProperty.prototype = {

_options : null,
	_propMap : null,
	_nameMap : null,
	_optionArray : null,
	
	_default : {
		acceptPropLabelPrefix : "label:",
		subjectATTEDUriPhrase : "http://atted.jp/data/locus/",
		subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene="
	},
	
	_init : function(options) {
		this._options = $.extend({}, this._default, options);
		this._propMap = [];
		this._nameMap = [];
		this._initPropMap(this._options);
	},
	
	_initPropMap : function(opts) {
		var self = this, workId = opts.workId, fileName = opts.fileName;
		var method = function(properties) {
			self._fillPropMap(self, properties);
			self._initOptionArray(properties);
		}
		LinkData.getProperties(workId, fileName, method);
	},
	
	_fillPropMap : function(self, properties) {
		$.each(properties, function(key, value) {
			var label = self._getLabel(value);
			if (!self._propMap[label]) {
				self._propMap[label] = value;
			}
		});
	},
	
	_initOptionArray : function(propertyList) {
		var self = this, list = new Object();
		var workId = self._options.workId, fileName = self._options.fileName;
		self._optionArray = [];
		$.each(propertyList, function(key, value) {
			var propLabel = self._getLabel(value);
			if (!self._ignore(propLabel)) {
				var obj = {};
				obj.key = propLabel;
				obj.value = self._getDisplayLabel(propLabel);
				self._optionArray.push(obj);
			}
		});
	},
	
	_ignore : function(label) {
		var self = this;
		if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) {
			return false;
		}
		return true;
	},
	
	_getDisplayLabel : function(value) {
		var self = this;
		var propLabel = value;
		var arr = value.split(self._default.acceptPropLabelPrefix);
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},
	
	_getLabel : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	},

getOptionArray : function() {
		return this._optionArray;
	},
	
	getPropertyByLabel : function(label) {
		return this._propMap[label];
	},
	
	getGeneBySubject : function(subject) {
		var self = this, htmlExt = ".html", geneLabel;
		if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, "");
		} else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) {
			geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, "");
		}
		if (geneLabel && geneLabel.indexOf(htmlExt) > -1) {
			geneLabel = geneLabel.replace(htmlExt, "");
		}
		return geneLabel;
	}
	
};

Application.timer = function() {
	this._init.apply(this, arguments);
};

Application.timer.prototype = {
	
	_delay : null,
	_retry : null,
	_maxRetry : null,
	
	_init : function() {
		this._delay = 1000;
		this._retry = 0;
		this._maxRetry = 1000;
	},
	
	call : function(func) {
		if (this._retry < this._maxRetry) {
			setTimeout(func, this._delay);
		}
		this._retry++;
	},
	
	setMaxRetryCount : function(no) {
		this._maxRetry = no;
	}
};

Application.tooltip = function() {
	this._init.apply(this, arguments);
};

Application.tooltip.prototype = {
	
	_toolTipList : null,
	
	_default : {
		explanationProperty : "explanation"
	},
	
	_init : function() {
		this._toolTipList = [];
		this._initToolTip();
	},
	
	_initToolTip : function() {
		var self = this;
		var getFilesByTag = function(resultList) {
			$.each(resultList, function(workId, fileList) {
				$.each(fileList, function(fileKey, fileName) {
					self._getFilePropertyList(workId, fileName);
					return false;
				});
			});
		}
		LinkData.getFilesByTag(null, "tooltip", getFilesByTag);
	},
	
	_getFilePropertyList : function(workId, fileName) {
		var self = this;
		var index = new Application.index(1, 10000);
		var getProperties = function(propertyList) {
			$.each(propertyList, function(pKey, pValue) {
				if (pValue.indexOf(self._default.explanationProperty) > -1) {
					self._getSubjectList(workId, fileName, pValue, index);
					return false;
				}
			});
		}
		LinkData.getProperties(workId, fileName, getProperties);
	},
	
	_getSubjectList : function(workId, fileName, property, index) {
		var self = this;
		var getSubjects = function(subjectList) {
			self._getPropertyList(subjectList, workId, fileName, property, index);
		}
		LinkData.getSubjects(workId, fileName, getSubjects, index);
	},
	
	_getPropertyList : function(subjectList, workId, fileName, property, index) {
		var self = this;
		var getTriplesByProperty = function(tripleList) {
			self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index);
		}
		LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index);
	},
	
	_addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) {
		var self = this;
		for (var i = 0; i < subjectList.length; i++) {
			var key = self._getLabelAfterHash(subjectList[i]);
			var value = tripleList[i].object;
			self._addToolTip(key, value);
		}
		if (subjectList && subjectList.length == index.getItemCount()) {
			self._getSubjectList(workId, fileName, property, index.increment());
		}
	},
	
	_addToolTip : function(key, tooltip) {
		var obj = {};
		obj.key = key;
		obj.tooltip = tooltip;
		this._toolTipList.push(obj);
	},
	
	getByKey : function(key) {
		var self = this, tooltip;
		$.each(self._toolTipList, function(objKey, obj) {
			if (obj.key === key) {
				tooltip = obj.tooltip;
				return false;
			}
		});
		return (tooltip) ? tooltip : "";
	},
	
	_getLabelAfterHash : function(value) {
		var propLabel = value;
		var arr = value.split("#");
		if (arr.length > 1) {
			propLabel = decodeURIComponent(arr[1]);
		}
		return propLabel;
	}
	
};

$(document).ready(function(){
	var fillDatabase = function(resultList) {
		$(".highChartDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>");
		$.each(resultList, function(workId, fileList) {
			$.each(fileList, function(fileKey, fileName) {
				$(".highChartDatabase").append("<option value='" + workId + "|" + fileName + "'>" + fileName + "</option>");
			});
		});
		$(".highChartDatabase").change(function() {
			var dbKey = $("option:selected", $(this)).val();
			if (dbKey == -1) {
				$("#container").html("");
				return;
			}
			var array = dbKey.split("|");
			var containerId = "container";
			var options = {
				workId : array[0],
				fileName : array[1],
				baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC"
			};
			new Application.highChart(containerId, options);
		});
	}
	LinkData.getFilesByTag(null, "database", fillDatabase);
});

 
LocusSelect = function(containerId, options) {    new Application.highChart(containerId, options);}; if (Application === "undefined" || !Application) {    var Application = {};} Application.highChart = function() {    this._init.apply(this, arguments);}; Application.highChart.prototype = {        _containerId : null,    _options : null,    _workId : null,    _fileName : null,    _highChartContainerId : null,    _appProperty : null,        _default : {        appName : "LocusSelect",        filterNamespace : "http://linkdata.org/",        subjectUriPhrase : "http://atted.jp/data/locus/",        subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=",        selectSubjectClass : "selectSubject",        drawArea : "drawArea",        loadingImageContainer : "loadingImageContainer",        acceptPropLabelPrefix : "label:",        loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif",        databaseInfoClass : "databaseInfo",        dbInfoLinkClass : "dbInfoLink",        geneInfoLinkClass : "geneInfoLink",        geneInfoAttedLinkClass : "geneInfoAttedLink",        geneInfoPpdbLinkClass : "geneInfoPpdbLink",        geneInfoEfpLinkClass : "geneInfoEfpLink",        geneInfoHannaDbLinkClass : "geneInfoHannaDbLink",        serverUrl : "http://linkdata.org/",        yAxisLabel : "Gene Expression Level"    },        _tooltipName : {        selectProperty : "selectproperty",        atted2 : "atted-ii",        hanaDb : "hanadb",        efp : "efp",        ppdb : "ppdb",        replace : "replace",        manuallyInputMotif : "userinputmotif",        locusSelect : "locusSelect"    },        _init : function(containerId, options) {        this._containerId = containerId;        this._options = $.extend({}, this._default, options);        this._workId = this._options.workId;        this._fileName = this._options.fileName;        var date = new Date();        this._highChartContainerId = "high_chart_" + date.getTime();        this._initToolTip();        this._initAppProperty(this._options);        this._initView();    },        _initToolTip : function() {        var self = this;        self._tooltip = (self._options.tooltip) ? self._options.tooltip : new Application.tooltip();    },        _initAppProperty : function(opts) {        var obj = {            workId : opts.workId,            fileName : opts.fileName        };        this._appProperty = new Application.motifProperty(obj);    },        _initView : function() {        var self = this;        var initView = function(subjectList) {            var sb = [];            sb[sb.length] = "<div class='row'>";            sb[sb.length] = "<div class='label left'>Select Locus</div>";            sb[sb.length] = "<div class='left'>";            sb[sb.length] = "<select class='" + self._default.selectSubjectClass + "'>";            sb[sb.length] = "<option value='" + -1 + "'>-- Select Locus --</option>";            $.each(subjectList, function(subKey, subValue) {                var label = self._getLabel(subValue);                sb[sb.length] = "<option value='" + subValue + "'>" + label + "</option>";            });            sb[sb.length] = "</select>";            sb[sb.length] = "</div>";            sb[sb.length] = "</div>";            sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>";            sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>";            sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>";            sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>";            sb[sb.length] = "</div>";            $("#" + self._containerId).html(sb.join(""));

body {
    font-family: sans-serif;
    font-size: 14px;
}
a {
    color: #3B5998;
    font-weight: bold;
    text-decoration: none;
}

.hidden {
	display:none;
}

.left {
    float: left;
}

.label {
	color: #E87B10;
    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";
    height: 24px;
    min-width: 125px;
}

.row {
    padding: 5px 0;
}

.row:after {
    content: "";
    clear: left;
    display: block;
}

.row input[type="text"] {
    width: 200px;
}

.row .externalLink {
	margin: 0 5px;
}

.btn {
  display: inline-block;
  *display: inline;
  /* IE7 inline-block hack */

*zoom: 1;
  padding: 4px 10px 4px;
  margin-bottom: 0;
  font-size: 13px;
  line-height: 18px;
  color: #333333;
  text-align: center;
  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);
  vertical-align: middle;
  background-color: #f5f5f5;
  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));
  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);
  background-image: linear-gradient(top, #ffffff, #e6e6e6);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);
  border-color: #e6e6e6 #e6e6e6 #bfbfbf;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
  border: 1px solid #cccccc;
  border-bottom-color: #b3b3b3;
  -webkit-border-radius: 4px;
  -moz-border-radius: 4px;
  border-radius: 4px;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);
  cursor: pointer;
  *margin-left: .3em;
}

.btn:hover,
.btn:active,
.btn.active,
.btn.disabled,
.btn[disabled] {
  background-color: #e6e6e6;
}

.btn:hover {
  color: #333333;
  text-decoration: none;
  background-color: #e6e6e6;
  background-position: 0 -15px;
  -webkit-transition: background-position 0.1s linear;
  -moz-transition: background-position 0.1s linear;
  -ms-transition: background-position 0.1s linear;
  -o-transition: background-position 0.1s linear;
  transition: background-position 0.1s linear;
}

.btn-blue,
.btn-blue:hover,
.btn-yellow,
.btn-yellow:hover,
.btn-red,
.btn-red:hover,
.btn-green,
.btn-green:hover,
.btn-lightblue,
.btn-lightblue:hover,
.btn-black,
.btn-black:hover {
  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);
  color: #ffffff;
}

.btn-blue {
  background-color: #0074cc;
  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);
  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));
  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);
  background-image: -o-linear-gradient(top, #0088cc, #0055cc);
  background-image: linear-gradient(top, #0088cc, #0055cc);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);
  border-color: #0055cc #0055cc #003580;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}

.btn-blue:hover,
.btn-blue:active,
.btn-blue.active,
.btn-blue.disabled,
.btn-blue[disabled] {
  background-color: #0055cc;
}

.btn-green {
  background-color: #5bb75b;
  background-image: -moz-linear-gradient(top, #62c462, #51a351);
  background-image: -ms-linear-gradient(top, #62c462, #51a351);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));
  background-image: -webkit-linear-gradient(top, #62c462, #51a351);
  background-image: -o-linear-gradient(top, #62c462, #51a351);
  background-image: linear-gradient(top, #62c462, #51a351);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);
  border-color: #51a351 #51a351 #387038;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-green:hover,
.btn-green:active,
.btn-green.active,
.btn-green.disabled,
.btn-green[disabled] {
  background-color: #51a351;
}
.btn-green:active,
.btn-green.active {
  background-color: #408140 ¥9;
}
.btn-lightblue {
  background-color: #49afcd;
  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));
  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);
  background-image: linear-gradient(top, #5bc0de, #2f96b4);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);
  border-color: #2f96b4 #2f96b4 #1f6377;
  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);
  filter: progid:dximagetransform.microsoft.gradient(enabled=false);
}
.btn-lightblue:hover,
.btn-lightblue:active,
.btn-lightblue.active,
.btn-lightblue.disabled,
.btn-lightblue[disabled] {
  background-color: #2f96b4;
}

 
body {    font-family: sans-serif;    font-size: 14px;}a {    color: #3B5998;    font-weight: bold;    text-decoration: none;} .hidden {    display:none;} .left {    float: left;} .label {    color: #E87B10;    font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif";    height: 24px;    min-width: 125px;} .row {    padding: 5px 0;} .row:after {    content: "";    clear: left;    display: block;} .row input[type="text"] {    width: 200px;} .row .externalLink {    margin: 0 5px;} .btn {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */   *zoom: 1;  padding: 4px 10px 4px;  margin-bottom: 0;  font-size: 13px;  line-height: 18px;  color: #333333;  text-align: center;  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);  vertical-align: middle;  background-color: #f5f5f5;  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);  background-image: linear-gradient(top, #ffffff, #e6e6e6);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);  border-color: #e6e6e6 #e6e6e6 #bfbfbf;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  filter: progid:dximagetransform.microsoft.gradient(enabled=false);  border: 1px solid #cccccc;  border-bottom-color: #b3b3b3;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);  -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05);  cursor: pointer;  *margin-left: .3em;} .btn:hover,.btn:active,.btn.active,.btn.disabled,.btn[disabled] {  background-color: #e6e6e6;} .btn:hover {  color: #333333;  text-decoration: none;  background-color: #e6e6e6;  background-position: 0 -15px;  -webkit-transition: background-position 0.1s linear;  -moz-transition: background-position 0.1s linear;  -ms-transition: background-position 0.1s linear;  -o-transition: background-position 0.1s linear;  transition: background-position 0.1s linear;} .btn-blue,.btn-blue:hover,.btn-yellow,.btn-yellow:hover,.btn-red,.btn-red:hover,.btn-green,.btn-green:hover,.btn-lightblue,.btn-lightblue:hover,.btn-black,.btn-black:hover {  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);  color: #ffffff;} .btn-blue {  background-color: #0074cc;  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);  background-image: -o-linear-gradient(top, #0088cc, #0055cc);  background-image: linear-gradient(top, #0088cc, #0055cc);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);  border-color: #0055cc #0055cc #003580;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  filter: progid:dximagetransform.microsoft.gradient(enabled=false);} .btn-blue:hover,.btn-blue:active,.btn-blue.active,.btn-blue.disabled,.btn-blue[disabled] {  background-color: #0055cc;} .btn-green {  background-color: #5bb75b;  background-image: -moz-linear-gradient(top, #62c462, #51a351);  background-image: -ms-linear-gradient(top, #62c462, #51a351);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));  background-image: -webkit-linear-gradient(top, #62c462, #51a351);  background-image: -o-linear-gradient(top, #62c462, #51a351);  background-image: linear-gradient(top, #62c462, #51a351);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);  border-color: #51a351 #51a351 #387038;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  filter: progid:dximagetransform.microsoft.gradient(enabled=false);}.btn-green:hover,.btn-green:active,.btn-green.active,.btn-green.disabled,.btn-green[disabled] {  background-color: #51a351;}.btn-green:active,.btn-green.active {  background-color: #408140 ¥9;}.btn-lightblue {  background-color: #49afcd;  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);  background-image: linear-gradient(top, #5bc0de, #2f96b4);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);  border-color: #2f96b4 #2f96b4 #1f6377;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  filter: progid:dximagetransform.microsoft.gradient(enabled=false);}.btn-lightblue:hover,.btn-lightblue:active,.btn-lightblue.active,.btn-lightblue.disabled,.btn-lightblue[disabled] {  background-color: #2f96b4;} 

 
<div class="row">    <div class="label left">Select Database</div>    <div class="left"><select class="highChartDatabase"></select></div></div><div id="container"></div> 

Select Input Data

LinkData Work	Table Data
Circadian Genomic (DIURNAL + PPDB promoter motif) Full	DiurnalHours_PPDB_COL_LDHH DiurnalHours_PPDB_COL_SD DiurnalHours_PPDB_DD_DDHC DiurnalHours_PPDB_LDHC DiurnalHours_PPDB_LDHH_SM DiurnalHours_PPDB_LDHH_ST DiurnalHours_PPDB_LER_SD DiurnalHours_PPDB_LIGHT5_HIF138_13 DiurnalHours_PPDB_LIGHT5_HIF138_8 DiurnalHours_PPDB_LIGHT5_znknOX DiurnalHours_PPDB_LL12_LDHH DiurnalHours_PPDB_LL23_LDHH DiurnalHours_PPDB_LLHC DiurnalHours_PPDB_LL_LDHC DiurnalHours_PPDB_LL_LLHC DiurnalHours_PPDB_lhyox_SD DiurnalHours_PPDB_longday DiurnalHours_PPDB_lux_2_LDHH DiurnalHours_PPDB_phyB9_SD DiurnalHours_PPDB_shortday
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full	AtGenExpress_ATTED_Flowering AtGenExpress_ATTED_Fruit_Seeds AtGenExpress_ATTED_Leaf AtGenExpress_ATTED_Root AtGenExpress_ATTED_Seedling AtGenExpress_ATTED_Stem AtGenExpress_ATTED_Whole_Plant Heptamer_elements PPDB_position

Add LinkData work(LinkData)

Click the Browse button or drag and drop to choose files to upload

The Maximum upload size is 1MB.(bmp,gif,jpeg,jpg,png)

Edit Application

Please enter information for the application to be registered.

*Required field

Account Name

Application Name*: Remove; Add name for another language

Collaborators

Image: You can upload jpg, gif, png file formats

Website: x

Add website

Tag

License

API version

Initial Cost: ￥

Annual Cost: ￥

Description: Remove; Add description for another language

Security Level: Public
Here anyone can access the page for this application.
Only those who know the link
Only those who know the URL of the page for this application can access this page.
Private
Only the contributor of this application can access the page for this application.

: finish Editing

Select Input Data

Edit Application

Please enter information for the application to be registered.

History